1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
3 years ago
12

A 4-year-old child who has never been separated from parents or siblings is admitted to the hospital. what is most important for

the nurse to encourage the parents to do?
Biology
1 answer:
ahrayia [7]3 years ago
4 0
<span>Since the child has never been away from his parents and siblings and also he is only 4 years old it is better to have one of them stay with the child. The presence of a family member will reinforce trust and provide support to the kid.</span>
You might be interested in
What activities damage our lungs
scoray [572]

Smoke: As we all know, cigarettes include toxic substances that trigger inflammation and destroy the lungs’ structure.1.

Mold: If too much moisture is present, mold can grow and become damaging to your airways. 2.

Chemicals: Inhaling chemical-filled air with things like noxious gas, chlorine, cleaning supplies and more can lead to threatening lung diseases.3.

Dust: Lung tissues can collect dust and particles over time which ends up injuring the airways.4.

Pollution: Not only can breathing in air pollutants cause irritation in your airways, but it also could lead to long-term lung damage.5.

3 0
3 years ago
Read 2 more answers
Which statement best describes the role of DNA ? It transmits genetic information to the next generation. It speeds up chemical
ValentinkaMS [17]

Answer:

It transmits genetic information to the next generation

Explanation:

DNA stores information on how the cell should be made and ‘run’. This is why it is critical that its integrity is well preserved. Otherwise, mutations on DNA can be lethal to the cell. In higher cells, DNA is protected in the nucleolus. To pass down the genetic information, DNA is replicated by DNA polymerases and then during cell division, either copy of the pair goes to each of the two daughter cells.

3 0
3 years ago
Read 2 more answers
A sugar, a phosphate group, and a nitrogen base form the building blocks of which organic compound?
Zina [86]
Nucleic acids / aka nucleotides
6 0
3 years ago
Select from the drop-down to correctly complete the statement.
Luba_88 [7]

Answer:

If we're talking about one specific element, then your answer is A) alike.

5 0
3 years ago
Read 2 more answers
What is the tense of the underlined verb?
zalisa [80]
If the underlined verb is <em>will have been talking, </em>in the sentence Lillian will have been talking for two hours by the time she finishes her classical music lecture, then the correct answer is D. future perfect progressive.
A would be - will talk.
B would be - will have talked.
C would be - will be talking. 
7 0
3 years ago
Other questions:
  • In in pex-4, activity 4, which patients would be diagnosed with primary hypercortisolism? patients 1 and 2 patients 4 and 5 pati
    14·1 answer
  • In which aquatic ecosystem would this tree most likely
    13·2 answers
  • Which type of fungus is shown in the diagram ?
    15·1 answer
  • In the western U.S., ranchers aggressively killed wolves because they posed a threat to their cattle. As the wolf population dec
    11·1 answer
  • If an object is less dense that the liquid it is placed into, what will happen?
    7·1 answer
  • Photosynthesis allows organisms to harvest the Sun's emergy to produce<br> _______
    5·2 answers
  • Which discovery did Gregor Mendel make?
    10·2 answers
  • Vocabulary: aerobic respiration, anaerobic respiration, ATP, cellular respiration, chlorophyll, chloroplast, cytoplasm, glucose,
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Describe one method for temporarily storing carbon in the natural cycle.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!