1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
4 years ago
9

What happens during the G1 phase of the cell cycle?

Biology
1 answer:
evablogger [386]4 years ago
8 0

The cell grows to its mature size

You might be interested in
What two components are found as part of an enzyme
krok68 [10]

Answer:

Active site and protein.

Explanation:

The two components which are often found as part of an enzyme are Active site and protein. Proteins are referred to as macromolecules or macromolecules which consists of more or one of a chain of amino acid residue. They do perform an array of functions which are within organisms.

7 0
2 years ago
What is the difference between an excitatory postsynaptic potential and an inhibitory postsynaptic
Vikki [24]

Answer:

A postsynaptic potential is defined as excitatory if it makes it easier for the neuron to fire an action potential. ... A postsynaptic potential is considered inhibitory when the resulting change in membrane voltage makes it more difficult for the cell to fire an action potential, lowering the firing rate of the neuron.

8 0
3 years ago
Read 2 more answers
Which of the following statements about the two strands of a DNA molecule is true?
zheka24 [161]
A T base on one strand always pairs with an A base on the other strand
8 0
3 years ago
Select the correct answer.
zhannawk [14.2K]

Answer:

A

Explanation:

Because gases dont have definite volume i learned it in chemistry at cookeville high school

4 0
3 years ago
The variability in marine salinity between habitats does not impact the fish living there.
nikitadnepr [17]
Well, there are two kinds of organisms: osmoregulators, that can regulate the level of salt and the salinity does not affect them (an example is salmon: for salmon this sentence is true. Generally, for most fish this sentence is true)

However, for some species, such shark - osmoconformers - this is false: they are affected by the salinity. in general I would conclude that This is false: the marine salinity DOES affect the fish (and other organisms) living there.
4 0
4 years ago
Read 2 more answers
Other questions:
  • Use the normal ecg trace below to determine how many seconds the trace represents as well as the heart rate.
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of these polymers is responsible for your inheritance?
    13·2 answers
  • How is a cell membrane like a window screen?
    6·1 answer
  • Deep sea corals can be hundreds or thousands of years old. Please select the best answer from the choices provided T F
    14·2 answers
  • If you were to leave a pan of water outside for several days what would happen
    6·1 answer
  • Formulez des hypothèses sur le mode de contamination d'un individu et citez au moins deux conseils pour prévenir la contaminatio
    8·1 answer
  • Human caused reductions of biodiversity, include pollution, invasive species, and overexploitation.
    15·1 answer
  • Which material would get electrons from the source to the load the fastest
    6·1 answer
  • The fish shown here is normally found in a pond but is being studied in an aquarium. The amount of water and salt intake and exc
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!