AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
A frame shift mutation is the shift of the genetics of an object.
This type of mutation os caused by the insertion or deletion of nucleotides in a DNA sequence that is not divisible by three.
<span>specialized cells, thats what bone and blood cells are considered </span>
Is there anything you need help with for this problem? I need to clarify first before answering your question.
Answer:
Coral!
Explanation:
I learned this is a biology class a while ago!