1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
10

Most living things need oxygen to survive. These two body systems bring oxygen into your body and then move to all your body par

ts. What are these two body systems?
A) respiratory and muscular
B) digestive and circulatory
C) respiratory and digestive
D) circulatory and respiratory
Biology
2 answers:
Vikki [24]3 years ago
5 0
A is the answer i believe
Grace [21]3 years ago
3 0
Respiratory and digestive 
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What is a frame shift mutation? What is the cause of this type of mutation?
astra-53 [7]
A frame shift mutation is the shift of the genetics of an object.
This type of mutation os caused by the insertion or deletion of nucleotides in a DNA sequence that is not divisible by three.
7 0
3 years ago
Bone and blood cells are considered?
GenaCL600 [577]
<span>specialized cells, thats what bone and blood cells are considered </span>
5 0
3 years ago
Read 2 more answers
Breathing is required for cellular respiration
solmaris [256]
Is there anything you need help with for this problem? I need to clarify first before answering your question.
8 0
2 years ago
16. Name one organism that reproduces through binary fission​
Grace [21]

Answer:

Coral!

Explanation:

I learned this is a biology class a while ago!

3 0
3 years ago
Other questions:
  • List the steps of how a squirrel hibernates.
    15·1 answer
  • The basic function of the pulmonary​ system, known as​ "ventilation," refers to​ what?
    6·1 answer
  • When the mouth develops from the first opening in the gastrula, the organism is called a deuterostome.
    8·1 answer
  • Which type of human cell is the most common site for fermentation
    14·2 answers
  • Why is it important not to misuse or over use antibiotics
    7·1 answer
  • What is the name given to cell division in eukaryotes
    13·1 answer
  • What do you think would have happened to the deer on the island had wolves NOT been introduced?
    13·2 answers
  • Desenvolvimento Sustentável - 1ª Série do EM- Biologia Habilidades do Currículo Paulista: EF09CI13 Propor iniciativas individuai
    7·1 answer
  • Frameshift mutation are the result of what occurrence?​
    10·1 answer
  • How do the oxygen and nutrient levels in the adult vena cava compare to those levels in the fetal vena cava?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!