Answer:
Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into the atmosphere
Explanation:
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
1. B
2. D
3. A
4. D
5. B
6. B
7. A
8. A
9. D
10. A
I just took this quiz and got 100%... Hope this helps!
Answer:
Mitosis
Explanation:
Mitosis is not a source of genetic mutation because it take place mostly in the somatic cells. This is because it does not lead to the production of gametes . In mitosis, the parent cells divide into two daughter cells and each daughter cells are genetically identical to the parent cell because they carry the same number of chromosomes as the parent cell. There is no genetic variation in this.
Answer:
Coombs reagent is an antiserum with antibodies that bind to the human <u>antibodies attached on the surface of the erythrocytes.</u>
Explanation:
Coombs test is a blood test used in immunology and immunohematology. It is of two types: direct and indirect.
The Coombs reagent is an antiserum, containing antibodies.
The direct Coombs test detects the antibodies present on the surface of the erythrocytes.
In this test, when the Coombs reagent is reacted with the blood to be tested, <u>the antibodies in the Coombs reagent binds to the antibodies attached on the surface of the erythrocytes in the test blood and cause agglutination.</u>
