1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rodikova [14]
3 years ago
12

According to karl menninger, individuals who harm themselves by means of drugs, alcohol, smoking, or reckless driving are effect

ively dying by
Biology
1 answer:
8090 [49]3 years ago
7 0
<span>For the answer to the question above, individuals who harm themselves by means of drugs, alcohol, smoking, or reckless driving are effectively dying by <u>"Chronic Suicidal" </u></span><span>according to Karl Menninger</span>

The answer is <u>"Chronic Suicidal"
</u>
I hope this helps<u>.
</u>

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
True or False<br><br>A hypothesis can be described as a possible proof.
juin [17]
<span>it is false.</span> it can't because it a guest so no.
 
7 0
3 years ago
1 pts
AlexFokin [52]

Answer:

Messenger RNA (mRNA), molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasm (the ribosomes).

4 0
2 years ago
Which example involves a cell membrane receiving and sending messages?
Gekata [30.6K]
The answer is B

I had this question

Hope this helps :)
7 0
3 years ago
in israel the enviromental impact of irrigation is lessened because the israelis use the most efficient irrigation method which
navik [9.2K]
Drip irrigation I do believe
4 0
3 years ago
Other questions:
  • When artery muscles contract, _____.
    9·1 answer
  • What is a single unit of hereditary information?
    5·1 answer
  • Mitosis is done to produce _____ calls.​
    9·1 answer
  • Tallness (T) is dominant to shortness (t) in pea plants. Which of the following represents a genotype of a pea plant that is het
    12·1 answer
  • Which of the following is (are) part of a systemic immune response?
    11·1 answer
  • What are the two most essential components of any medium, regardless
    11·1 answer
  • The smallest functional unit of a living thing is a
    11·1 answer
  • Segments of DNA that contain the code for specific proteins are called.
    13·1 answer
  • Cardiac muscle has prolonged contraction due to a sodium induced-calcium released process into the cytoplasm of the cell. Cardia
    15·1 answer
  • Where is water found in... lithosphere, asthenosphere, the mental, or earths core?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!