1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
11

What can be done to improve soil fertility?

Biology
2 answers:
Dennis_Churaev [7]3 years ago
6 0
I think the answer is A.
Bess [88]3 years ago
4 0
D- all of these answers are correct
You might be interested in
Some one help please!! Im timed Will mark Brianlyest
andrezito [222]

Answer:

water table

Explanation:

brainliest pls.

5 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
1. Explain the difference between observations and inferences.
love history [14]

Answer:

The act of carefully watching or examining a person or object when something is happening is known as an observation. An act of deriving rational conclusion from known facts or circumstances is called inference. ... On the other hand, the inference is an explanation or assumption of what one has perceived or seen.

Explanation:

5 0
3 years ago
Read 2 more answers
Robert experienced bradycardia, or slowing of the heart rate, after using certain eye drops prescribed to him for his glaucoma.
just olya [345]

He is experiencing an overdose of drugs to treat could occur if they are taken improperly, or if decreased liver or renal function occurs. Symptoms of overdose include severe nausea/vomiting, sweating, salivation, hypotension, bradycardia, convulsions, and increased muscle weakness, including respiratory muscles. This patient has diabetes and thus may have glycaemic issues. Bradycardia and muscle weakness.  Abdominal pain and dry mouth. Tachycardia and hypertension.  Emotional withdrawal and tachypnea.

6 0
3 years ago
Read 2 more answers
Which of the following indicates that only a physical change has taken place?
siniylev [52]
A change in the color of a substance -- this one is indeed a chemical change. Think of iron, if iron turns reddish, it's a completely different substance.
8 0
3 years ago
Other questions:
  • Cancer is a disease of enhanced proliferation and cell survival. DNA repair mechanisms are normally important for cell survival.
    12·1 answer
  • What is the main difference between a mixture and a pure substance
    14·1 answer
  • You feed a canned dog food that is 75% moisture. When analyzed, it contained 30% crude protein and 1.20% calcium on a dry matter
    11·1 answer
  • Need help with this question. (Explain Ali's observation)​
    8·1 answer
  • Please help quickly!
    13·1 answer
  • Fossils in _______ layers of rock are generally estimated to be _______ than fossils found in the deeper layers. (3 points)
    11·2 answers
  • Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the
    13·1 answer
  • 29. Magellan was released in 1989 by the Space Shuttle Atlantis.
    13·1 answer
  • You stain a sample of bacteria using the Gram stain and see gram-positive rods. You then test a sample of the same bacteria usin
    15·1 answer
  • Is this statement accurate? Explain shortly Does it need to be reworded or does it need some additional comments about how the a
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!