Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The act of carefully watching or examining a person or object when something is happening is known as an observation. An act of deriving rational conclusion from known facts or circumstances is called inference. ... On the other hand, the inference is an explanation or assumption of what one has perceived or seen.
Explanation:
He is experiencing an overdose of drugs to treat could occur
if they are taken improperly, or if decreased liver or renal function occurs.
Symptoms of overdose include severe nausea/vomiting, sweating, salivation,
hypotension, bradycardia, convulsions, and increased muscle weakness, including
respiratory muscles. This patient has diabetes and thus may have glycaemic
issues. Bradycardia and muscle weakness.
Abdominal pain and dry mouth. Tachycardia and hypertension. Emotional withdrawal and tachypnea.
A change in the color of a substance -- this one is indeed a chemical change. Think of iron, if iron turns reddish, it's a completely different substance.