1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
3 years ago
11

Why is drinking water usually treated before it comes out of your faucet?​

Biology
1 answer:
frutty [35]3 years ago
3 0

Answer:

For public health and safety, water is treated before it reaches your faucet. Water treatment involves the removal of impurities that make water unsafe for human consumption. This water may flow from a surface water source, or it may be pumped from an aquifer. Hope this helps!!!

Explanation:

You might be interested in
What negative affects do humans have on the earths oceans
9966 [12]

Answer:

many

pollution by dumping chemical that are harmful to the animals

littering by plastic

accidentally introducing invasive species

over fishing

it lowers the biodiversity of the aquatic ecosystems living there

Explanation:

7 0
3 years ago
In areas where the walls are frequently washed, conduit should be mounted with a ___ inch air space between the wall and the con
Over [174]

In areas where the walls are frequently washed, conduit should be mounted with a 1/4 inch air space between the wall and the conduit.

Conduits are the structures that are hollow and cylindrical like a pipe, channel or tube through which any material can pass. The material can be electrical wires, gases or even water. Therefore, the functions of conduits is to mediate the transport of materials from one place to another.

These conduits can be rigid or flexible depending upon their use and the material to be transported. Care should be taken when these conduits are embedded inside the wall that they are not very close and in contact with the wall otherwise the conduits may get damaged.

To know more about conduit, here

brainly.com/question/28239111

#SPJ4

7 0
1 year ago
What is the correct labeling for the atom?
Ede4ka [16]

Answer:

I think the answer is A

Explanation:

D is pointing at specifically at electron which is the outer charger of the electron cloud. I don't think its likely to be D as the answer.

7 0
2 years ago
Sb-35 how does alcohol use affect boat operators or passengers?
Marina86 [1]
The use of alcohol by the operator can have an effect in operational safety of the vessel and that would include the crew as well as the passengers. Hope this is the right answer and would be of big help.
4 0
3 years ago
Read 2 more answers
Why do X-linked traits appear more often in males
Tpy6a [65]
X - linked traits appear more often in males because males only have one x chromosome. One copy of an x - linked trait is all that a male would need to possess that trait. Females have two x chromosomes, so they would require 2 copies of the x - linked trait in order to possess it.
8 0
3 years ago
Other questions:
  • The outward appearance of a particular trait is called the morphology genotype pedigree phenotype dominance.
    8·1 answer
  • In a pedigree, an open circle represents a
    15·1 answer
  • In intestinal epithelial cells, a transport protein moves the bulky, polar glucose molecules through the membrane into the cytop
    9·1 answer
  • DNA is double stranded helix
    5·2 answers
  • Which of the following is an example of potential rather than kinetic energy?light flashes emitted by a fireflya molecule of glu
    7·1 answer
  • Peptidoglycans are composed of sugars and _____
    12·1 answer
  • What is the source of geothermal energy?
    15·2 answers
  • The blood vessels that have the smallest diameter and consist of a single layer of simple squamous epithelial
    5·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • A student is collecting the gas given off from a frog living in an enclosed tank. The
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!