1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariulka [41]
3 years ago
12

what is the sensitivity of freshwater wetland? I have to give three pieces of evidence and explain why it is sensitive or why no

t...PLSS HELP
Biology
1 answer:
zlopas [31]3 years ago
5 0
When it comes to freshwater wetlands, hydrology plays a large role in nutrient stoichiometry and sensitivity to nutrient inputs. Although wetland biogeochemists intuitively understand these important relationships between landscape position, hydrology, and sensitivity to nutrient inputs, these relationships have never been quantified using geospatial data. The objective of this project will be to evaluate and quantify the linkages between watershed catchment characteristics and freshwater wetland nutrient sensitivity ur welcome
You might be interested in
Tay-Sachs disease is due to the absence of an enzyme that
Zepler [3.9K]

Answer: <em>D. Causes an accumulation of lipids in brain cells</em>

Explanation:

Tay-Sachs disease is caused by a genetic mutation in the <em>HEXA</em> gene. It is an autosomal recessive disease that causes the mutation on an enzyme, which metabolizes <em>GM2 Ganglioside</em> in nerve cells, this leads to a build-up of the molecule in brain cells. At the moment there is no cure for the disease, only support treatment is available.

5 0
3 years ago
Mitochondria contain their own double-stranded, circular DNA and replicate on their own. Why don't they suffer the same conseque
Maksim231197 [3]

Answer:

Mitochondrial DNA is circular, so it doesn't shorten when it replicates unlike the rest.

4 0
3 years ago
The surface area/volume ratio is an important factor for one celled organisms. As a cell's volume grows, its surface area/volume
Stells [14]

Answer

Use Mitosis to divide and create daughter cells.

Explanations  

Single-celled organisms use mitosis to reproduce. Both growth and reproduction in unicellular organisms are mutually inclusive. When the cell’s volume grows, the ratio of surface area to volume decreases creating challenges in acquisition of nutrients because there will be too much cytoplasm for a given amount of nuclear material , thus the cell divides by mitosis to reproduce daughter cells and the process begins again.

5 0
3 years ago
What pattern of migration do whales follow?
ella [17]
They go straight through the ocean?
6 0
3 years ago
The structure of the cell membrane was discovered in 1895 by _________. Finding a similarity to Olive Oil, he discovers membrane
timofeeve [1]

Answer:

C. Charles Overton , lipids

8 0
3 years ago
Other questions:
  • The first, or smallest, level of organization in the human body is the .
    12·1 answer
  • BRAINLIESTTT ASAP!
    11·1 answer
  • 1. What did Darwin’s research on the Galapagos Islands show?
    6·2 answers
  • What are two characteristics of a forest fire ?
    13·1 answer
  • Which scientific force is primarily responsible for maintaining control of your vehicle?
    14·1 answer
  • Thirty-five-year-old Lucy needs to have her blood taken. She is so distraught by this that she must mentally prepare herself for
    14·1 answer
  • compare the phase of meiosis 1 with the phase of meiosis 2 in terms of the number and arrangement of the chromosomes
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Orangutans are highly territorial primates. What is the most likely
    10·2 answers
  • Give differents between lytic and lysogenic cycles
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!