Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
They found a direct and positive relationship between the student’s creativity scores and their neural connectivity most especially in frontal lobe. Extremely creative contributors failed to suppress activity in the precuneus while engaging in a working memory task signifying that creativity may benefit from the co-activation of execution control and default mode networks.
Ans.
Tuberculosis (TB) is a bacterial infection that affects mainly respiratory tract and can be transmitted from one to another person through contaminated air. The causative agent of tuberculosis, <em>Mycobacterium tuberculosis</em> has developed resistance against many antibiotics, such as rifampin and isoniazid, which is known as tuberculosis drug resistance.
If a person infected with TB shows drug resistance against some TB drugs, 'doctors should give other TB drugs to that person, even if these drugs show less effect than common drugs'. This is because these drugs can prevent or kill the bacterium more effectively than the common drugs for which, bacterium is resistance.
A lipid does, it forms a phospholipid bilayer.
