1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
11

The majority of water on Earth is in which form?

Biology
2 answers:
bija089 [108]3 years ago
8 0

The majority of water on Earth is in which form?

Earths water is in the form of <em>Salt water</em>, I literally just took the test and got it correct.

iris [78.8K]3 years ago
3 0

Most of our earth's fresh water is in glaciers and polar ice caps.

You might be interested in
Which of the following statements is INCORRECT? Which of the following statements is INCORRECT? Mucous membranes line exits and
koban [17]

Answer:

The cutaneous membrane is made of a simple columnar epithelium

Explanation:

Cutaneous membrane is the membrane of the skin. This membrane protects the skin from the physical and chemical damage.

Cutaneous membrane is present on skin and exposed to the external environment. This membrane is made of stratified squamous epithelium and keratinized and consist of the underlying layer of dermis. Hence, the membrane is not made upof simple columnar epithelium tissue.

Thus, the correct answer is option (3).  

4 0
3 years ago
Determine which of the following characteristics are environmental, not inherited. I. Weight II. Blood group III. Language spoke
gregori [183]

Answer:

Weight and blood group

Explanation:

3 0
2 years ago
hey all of you science talents I am in desperate needs of your help. Please don't answer randomly. Try your best and DONT ANSWER
Alex

Answer:

1. 25%

2. 75%

3. 1:2:1

Explanation:

6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
To what are greater body size and facial gracility documented in homo erectus likely related?
Vanyuwa [196]
Greater body size and facial gracility documented in Homo erectus are likely related to changes in tool technology and increasing access to meat and other proteins. Homo erectus walked just like a modern human, with traits like double arches and adducted big toe, they had a cranial capacity range from 650 cc to 1,200 cc. 
5 0
3 years ago
Other questions:
  • What parts of the body are classified as connective tissue?
    6·1 answer
  • In what part of the cell cycle does the DNA make a copy of itself?
    11·1 answer
  • Imagine you are on a dinosaur fossil hunt with a famous paleontologist. Design a procedure for determining the relative and abso
    13·1 answer
  • Some mutations always occur from generation to generation but most mutations to not persisting overtime in the gene pool which m
    14·1 answer
  • Which factor MOST determines how fast a high and low air mass will move towards one another? A.Humidity B.distance C.temperature
    13·2 answers
  • A. True <br> b. False: decision structures are also known as selection structures.
    8·1 answer
  • One student made the incomplete diagram shown below to represent the relationship between magma igneous rocks and metamorphic ro
    6·1 answer
  • Which of the following are true of enzymes?
    5·1 answer
  • Which statement best describes the germ theory of disease?
    7·2 answers
  • following a meal, glucose must move from the gut lumen, where there is a high glucose concentration, through membrane proteins a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!