1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
5

What are some chemical propertys

Biology
2 answers:
QveST [7]3 years ago
7 0

A chemical property is a property of a substance that is observed when a substance undergoes a chemical change. Some chemical properties are toxicity, flammability, heat combustion, acidity/basicity, solubility.

topjm [15]3 years ago
7 0

A property of a substance is a characteristic of a substance, which can be either chemical or physical.

Chemical properties: observed in chemical changes.


Physical properties: observed in physical changes.




Hope it helped,




BioTeacher101

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which is the best example of Newton's Second Law of Motion?
kykrilka [37]
<span> If you use as much force on a bigger object and a smaller object the smaller object will have more acceleration, because the smaller object has less mass. </span>
8 0
3 years ago
Read 2 more answers
Which organelles allow plants to support heavy structures such as leaves and flowers?
son4ous [18]

Answer:

I believe the answer is C

Explanation:

In many plant cells there is a single large central vacuole filled with liquid, pressure of the central vacuole allows plants to support heavy structures such as leaves and flowers.

8 0
2 years ago
Read 2 more answers
The ________ requires property owners to pay to clean up waste that is hazardous
dsp73

Answer:

government that is your answer  

Explanation:

6 0
3 years ago
Freshwater fish need water near pH7.these fish prefer
mash [69]

A. Neutral water

Less than 7 is acidic (which has 6 letters, 6< 7)

More than 7 is alkaline (which has more than 7 letters). Alkaline = basic

7 is neutral

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a stage in life cycle of population
    8·1 answer
  • The table describes several organisms in a Georgia ecosystem.
    9·1 answer
  • 1. In eukaryotic flagella, the fibers that slide past one another due to the activity of dynein proteins are microtubules. 2. Ma
    11·2 answers
  • Bees with a larger wingspan were able to produce more offspring, making the trait more common. It could be said that ____ favore
    13·1 answer
  • What is positive feedback? What is negative feedback? Biology wise
    12·1 answer
  • PLEASE HELP HURRY PLEASEEEE
    5·2 answers
  • Which waves can you see?<br> microwaves<br> radio waves<br> visible light waves<br> gamma rays
    11·2 answers
  • A biologist studies a population of anteaters living in a large nature reserve. The reserve is surrounded by farms where anteate
    14·1 answer
  • Glucose is generally phagostimulatory (stimulates eating) for animals.<br><br> a. True<br> b. False
    9·1 answer
  • What is the scientific name of frog​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!