1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
12

System that transports nutrients and wastes and plays a role in the immune response.

Biology
1 answer:
jarptica [38.1K]3 years ago
6 0
The lymphatic system transports nutrients and wastes and also plays a role in the immune system
You might be interested in
Which condition is an inflammation of the tissues surrounding the brain and spinal cord?​?
I am Lyosha [343]
The correct answer is known as "Meningitis"

Meningitis is is an infection of the membranes (meninges) surrounding your brain and spinal cord. The swelling from the illness usually triggers signs which includes headache, fever and a stiff neck. Most cases of meningitis within the U.S. are because of a viral infection, however bacterial and fungal infections are other causes. some cases of meningitis enhance with out remedy in some weeks. Others may be fatal and require immediate antibiotic remedy
4 0
4 years ago
Read 2 more answers
Please help me 1.2.3.or 4. I need this
Pepsi [2]

Answer:

2) a feedback mechanism that regulates blood glucose level

8 0
3 years ago
Is my backyard considered an ecosystem?
zzz [600]

Answer:

Yes, it actually is!

Explanation:

Your backyard is a great example of an ecosystem. You may have a lawn, which sprouts mushrooms, is home to squirrels and birds, and other forms of life.

6 0
3 years ago
Read 2 more answers
Distinguish between incomplete dominance and codominance
mixas84 [53]

Answer:

In incomplete dominance a heterozygous individual blends the two traits. ... With codominance you'll see both alleles showing their effects but not blending whereas with incomplete dominance you see both alleles effects but they've been blended.

Explanation:

and i got my answer from brightstorm.com its a biology website we use at school

5 0
4 years ago
The current understanding of created "kinds" is:
TEA [102]

The current understanding of created "kinds" is related to higher taxonomic orders and it is not easy to explain or define the created “kinds” like species. Taxonomy is the branch of science in which we study about the classification of something but mostly it is related to the classification of organisms.

8 0
3 years ago
Other questions:
  • Water changes volume with changing temperature. Water's volume increases very rapidly between 0 degrees Celsius and 4 degrees Ce
    7·1 answer
  • What is an advantage and disadvantage to using lithium, ion batteries
    12·1 answer
  • Convection in the upper mantle
    9·2 answers
  • Which statement best describes how reproduction leads to natural selection in a population?
    14·2 answers
  • What percent of earth is made up of water?
    14·2 answers
  • Witch characteristics are always present in all living things
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • B) que es un elemento?<br><br>c) que es una molécula?​
    10·1 answer
  • Someone plz help me <br><br> A.a<br> B.b<br> C.c<br> Or<br> D.d
    11·1 answer
  • In the form of gene therapy used successfully for severe combined immunodeficiency syndrome, SCID-X 1, how is the genetic engine
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!