1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
12

System that transports nutrients and wastes and plays a role in the immune response.

Biology
1 answer:
jarptica [38.1K]3 years ago
6 0
The lymphatic system transports nutrients and wastes and also plays a role in the immune system
You might be interested in
Drag and drop each mutation to the picture that correctly represents the mutation.
german

Answer:

point mutation is left

chromosomal rearrangment is middle

non disjunctional is right

Explanation

GUNGAN_god#7570 on discord helped me out and he is a chemistry teacher,

3 0
3 years ago
Read 2 more answers
Which explains how buffers help cells to maintain homeostasis
nataly862011 [7]
To maintain homeostasis<span> in the blood and extracellular fluid. The most important way that the pH of the blood is kept relatively constant is by </span>buffers<span> dissolved in the blood.</span>
8 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Can someone please check my work ?
Tanya [424]

switch gene with traits and i think you will be good im not sure though

5 0
3 years ago
1. Which of the following correctly pairs a cellular structure with its function?
Marysya12 [62]

Answer:

I believe the correct answer is c

5 0
2 years ago
Other questions:
  • Which terrestrial planet has the highest surface gravity
    15·1 answer
  • Where does the movement energy found in falling rain come from originally?
    11·1 answer
  • Energy is converted from solar to chemical in Process A and then from one form of chemical to another in Process B.
    6·2 answers
  • Which process increases genetic variation among whale offspring
    7·1 answer
  • PLEASE help me I have NO IDEA what this means....
    9·1 answer
  • In meiosis, the original cell is diploid or haploid
    15·1 answer
  • Is the back line on volleyball court Ace​
    15·1 answer
  • HELP PLEASE (big test has to be right) In a diploid cell containing 32 chromosomes, the resulting daughter cells formed during m
    5·1 answer
  • Which of these can be used to determine the rate of
    15·1 answer
  • MRNA<br> UGU UAU AUC GAA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!