A substance that can dissolve other substances
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Animals, Humans, Oil, Gases, And Coal all contain Carbon Dioxide in our atomosphere.
Explanation:
Answer:
Evolution
Explanation:
Evolution is the change in habits, hereditary and physical characteristics of a species over various generations in response to environmental conditions. Evolution lead to adaptation, the nature selection of the fittest and elimination of remaining.
Evolution may produce variety and diversity in response to mutation, genetic drift and other genetic variation. These changes may pass to offspring and may express them more in one group of population.
Evolution also explain the unity among organisms by explaining their shared characteristics. This refers to their common ancestors.
Answer:
The lectin pathway or lectin complement pathway is a type of cascade reaction in the complement system, similar in structure to the classical complement pathway, in that, after activation, it proceeds through the action of C4 and C2 to produce activated complement proteins further down the cascade.
