All categories

3 years ago

true/false. The pacific northwest is home to a temperate rain forest, where over 300 centimeters of rain falls yearly

Biology

1 answer:

TEA [102]3 years ago

4 0

It is true, The pacific northwest is home to a temperate rain forest, where over 300 centimeters of rain falls yearly.

You might be interested in

Which process contributes most to the formation of a sinkhole?

r-ruslan [8.4K]

Moist ground and or eathquakes

5 0

3 years ago

Photochemical smog results from automobile pollutants reacting with

dlinn [17]

Photochemical smog results from automobile pollutants reacting with ultraviolet light from the sun. <span>Nitrogen oxides released from the automobile are introduced into the atmosphere reacts with sunlight to produce singular oxygen atoms. Oxygen atoms then combine with molecular oxygen to produce ozone which is one of the components of photochemical smog.</span>

8 0

2 years ago

Read 2 more answers

Animals and plants use the chemical energy stored carbohydrates to fuel their own life processes, ultimately breaking down these

Juliette [100K]

Answer:

A good example happens during the breakdown of food particles.

Explanation:

The chemical energy stored in food is a type of potential energy. Transformation of this energy into kinetic energy happens during chemical reactions that takes place during digestion. A good example of kinetic energy is therefore the breakdown of carbohydrates into carbon dioxide, water and heat.

8 0

3 years ago

What types of energy do you think may have been involved when the Bunsen burner was lit with

Katen [24]

Heat, light, sound and fire may have been involved when the Bunsen burner was lit with the spark from the Van de Graaff generator. Bunsen burner is a common device in the lab.

<h3>What is a Bunsen burner?</h3>

Bunsen burner is a laboratory device (gas burner) that generates a single open gas flame.

The gas most commonly used in Bunsen burner is generally natural gas, i.e., methane gas.

This device (Bunsen burner) can be used to generate a heat source during a lab experiment.

Learn more about the Bunsen burner here:

brainly.com/question/10281181

3 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago