Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The question lacks options, the options are:
A. understand the viewpoint of other people.
B. realize that the term heavy describes an object one way and the term big describes it another way
C. understand that six ounces of liquid in a jar and six ounces in an elongated tube are equal.
The answer is C
Explanation:
Piaget proposed the theory of cognitive development, which talks about how human intelligence is developed. Piaget worked with Children because he believed they played a significant role in the development of cognitive intelligence. Based on his work, he proposed four stages of cognitive development viz: sensorimotor, preoperational, concrete operational and formal operational stages.
However, in the preoperational stage, Piaget described children between ages 2-7 as being in this stage of cognitive development where they are yet to comprehend mental logic. One characteristics of this stage is CONSERVATION, which is the ability to know that changing a substance's appearance doesn't change the properties of that substance. Piaget proposed that Children between the ages of 2-7 lacked this conservative characteristics.
He performed an experiment where he used two beakers with the same amount of liquid. He then emptied the contents of one of the previous beakers into a new beaker with different shape (longer). Piaget was able to notice that Children at the pre-operational stage were unable to understand that the contents of the two beakers (longer one and previous beaker) were still the same despite the beaker has been changed.
Hence, according to Piaget, a child has acquired the cognitive skill of conservation when he/she is able to understand that six ounces of liquid in a jar and six ounces in an elongated tube are equal.
If by magna you mean magnitude, then this is false. By increasing magnitude, you decrease the diameter of the field.
Hi there!
The answer should be True.
Hope this helps!
-Payshence xoxo
