1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
3 years ago
15

2. How do the effects of insulin resistance compound to decrease cellular responses to insulin?

Biology
2 answers:
True [87]3 years ago
8 0

Insulin resistance results in a decrease uptake of glucose from the bloodstream. This causes high blood glucose levels which in turn stimulate pancreatic cells to continue to secrete insulin.

Further Explanation:

Insulin is a kind of a hormone in the body produced by the pancreatic cell. It increases the rate of absorption glucose in the body and maintains the level of glucose in the body. When there is any disturbance in this hormone. Then this can cause several health and body dysfunction. Diabetes is a kind of disease which is developed when the level of glucose is elevated in blood than the normal level.

The insulin receptor has very low kinase activity which leads to very less binding sites for the singling effectors. Therefore; the signaling factor are less activated. Also, feedback inhibition decreases the cellular binding of insulin to receptor. This leads to high glucose level in body. Thus, the insulin resistance compound increase the glucose level in blood and cause severe health disease. Also the cell requires higher level of insulin that means the cells that react to insulin are become resistant to its effect.

Learn more:

1. Learn more about the effects of alcohol on brain brainly.com/question/2034996

2. Learn more about alcohol is an antidepressant drug brainly.com/question/4541397

3. Learn more about the effect of alcohol on body weight brainly.com/question/826810

Answer Details:

Grade: High school

Subject: Health

Topic: Insulin

Keywords:

Insulin, diabetes, receptor, glucose, level, activated, feedback, concentration, health disease, cell, binding, kinase, effect, hormone, diabetes.

victus00 [196]3 years ago
4 0

Answer and explanation;

-The insulin receptor itself has decreased kinase activity leading to fewer binding sites for singling effectors to become activated.

Therefore; the signaling effectors are less likely to be activated.

-Additionally,, feedback inhibition decreases signaling effector binding to receptor.

-The lack of activation of these initial signaling effectors prevents any subsequent steps from happening.

-We can thus conclude this by saying that higher insulin concentrations are necessary to obtain the same level of signaling leading to physiological effects that would exist in someone without type-2 diabetes.

-Also the requirement for higher insulin concentration means that the cells that respond to insulin are resistant to its effect.

You might be interested in
DNA strand replication begins with an RNA primer. DNA strand replication begins with an RNA primer. True False
nikitadnepr [17]

Answer:

true

Explanation:

DNA synthesis is performed by the enzyme DNA polymerase. However, DNA polymerase requires the presence of a free 3' OH on the existing DNA or RNA segment. The enzyme primase forms small RNA segments that serve as primers. Primers are formed by using the DNA template strands and have free 3' OH ends. DNA polymerase extends the primers by adding deoxyribonucleotides according to the sequence of the DNA template strand. Therefore, DNA polymerases are the enzymes of primer elongation.

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Need help with this etm class
astra-53 [7]

Answer:

react with antigens and destroy them

4 0
3 years ago
28. What specific adaptation has the sub-type of CAM plants derived to reduce the amount of water lost in dry environments?
zhannawk [14.2K]

Answer: a. Stomata open at Night

Explanation:

As a tactic to minimize photorespiration in warm regions, many water-storing plants such as cacti and pineapples modified its method of carbon fixation. This process is called Crassulacean Acid Metabolism (CAM), following the plant family Crassulaceae, in which it was first identified. In these plants, the stomata (singular, stoma), specialized openings in the leaves of all plants through which CO2 enters and water vapor is lost, open during the night and close during the day. This model of stomatal opening and closing is the opposite of that in most plants.

8 0
3 years ago
In the lab, you will change the number of birds with each beak phenotype for the second and third generations. What row of the d
nlexa [21]

Answer:

Percentage of food eaten by the flock

Why is the percentage of food eaten a good number to use? Explanation:

A percentage compares the number of birds in the flock to the total number of birds in all flocks.

If the percentage is high, the flock is more successful, so the flock should grow.

If the percentage is low, the flock is struggling to eat, so the flock should shrink.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Electricity is added to recharge a battery. What is added to ADP to form ATP?
    13·2 answers
  • Gh
    13·1 answer
  • Why is air pressure greatest at the Earth's surface
    11·1 answer
  • Name a few behaviors of plants.<br><br><br> Name several behaviors of animals.
    10·1 answer
  • PLeAse PLeAse HeLp <br><br> Describe what happens when cells divide uncontrollably?
    5·1 answer
  • Which is a force that holds atoms together
    5·2 answers
  • At the end of mitosis, what develops around each set of chromosomes?
    11·1 answer
  • Bro you’re literally a furry
    9·2 answers
  • Which important event occurs in the second trimester? (1 point)
    7·1 answer
  • Hey guys can you guys help just to be sure im doing this right
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!