1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LUCKY_DIMON [66]
3 years ago
6

Compare and contrast contour feathers and down feathers

Biology
1 answer:
Diano4ka-milaya [45]3 years ago
4 0
Contour: Gives the bird its stream line shape. 


<span>Down feathers: Keeps the bird warm.</span>
You might be interested in
Julio blows air across his hot bowl of soup. The tiny ripples he creates are similar to
Bad White [126]
The answer would be Cyclones
8 0
2 years ago
Read 2 more answers
True or false: In a gel electrophoresis gel, a DNA fragment containing 100 bp (base pairs) would travel faster (and further) tha
vova2212 [387]

Answer: true

Explanation: In gel electrophoresis, the smaller the size/molecular weight of DNA the faster it moves across the gel and vise versa. This is as a result of the pore size of the gel which is usually prepared 1g of agarose in 100ml of distilled water. So a DNA fragment with 1000 base pairs will "struggle" its movement across the gel pore making it mive less faster and further. Movement and molecular weight of DNA are inversely proportional.

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Mitosis and meiosis similarities
Artist 52 [7]

The alternation of generations in the life cycle of a plant includes the diploid and haploid multicellular stages. diploid and haploid are copies of the chromosomes. The spores in the plant is unicellular and when they start dividing through mitosis, it produces identical cells. These identical cells are all haploid. Haploid stages contain one set of chromosome from either of the parent. These identical cells create a multicellular system called the gametophytes. A gametophyte is the haploid multicellular stage in the life cycle of a plant. The gametophyte makes the gametes. These gametes are responsible for sexual fertilization. It takes place when a sperm (male gametes) from the male fuses into the egg cell (female gametes) of the female. The formation of both male and female gametes creates a diploid zygote. Diploid stages contain one set of chromosome from each parent. This is where the sporophyte comes in. A sporophyte is the diploid multicellular stage in the life cycle of the plant. It now contains the two sets of chromosomes from each parent.

The type of cell division that produces gametes with half the normal chromosome number is the meiosis. Meiosis is the type of cell division used in sexual reproduction. It will occur in the testes and ovaries.

<span> </span>

4 0
3 years ago
Fern spores usually form during:<br><br> spring<br> winter<br> summer<br> fall
aivan3 [116]

Answer:

Late summer

Explanation:

many spores ripen in late summer

8 0
2 years ago
Other questions:
  • PLEASE HELP 10 POINTS!!!!
    6·2 answers
  • Is it true the environment can affect the way traits are expressed Explain
    11·2 answers
  • What a worm's body part that helps it dig tunnels Underground
    8·1 answer
  • Are carrots seedless ,vascular ,or both
    5·2 answers
  • Please help fill in blanks!!!!!!!! on this homework sheet please i need much help as possible
    7·1 answer
  • Colors of light most useful in photosynthesis are
    10·1 answer
  • The cell wall of a plant consist mostly of cellulose a carbohydrates which provides a strong structure. which of the following e
    6·2 answers
  • If a particular gene is located on the Z chromosome of this lizard species, describe why a lizard with a ZW genotype has a great
    10·1 answer
  • Incinerating or burning trash is the best way to get rid of the majority of it. True or False
    6·1 answer
  • Dorsal roots contain axons that bring ______ information to the spinal cord and ventral roots contain axons that bring _______ c
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!