1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
8

Explain why scientists classify organisms and how scientists classify species.

Biology
1 answer:
kondor19780726 [428]3 years ago
8 0

Answer:

  • Scientists classified the organism into different phylum and classes, because it is almost impossible for us to learn the characteristics of each and every organism.
  • It was need to classify the organism, so that it would be more easier for others to study.
  • Scientists classified the organism on the basis of their body structure, internal physiology, habitat they live in.  

You might be interested in
What would happen to your dragon if the 10th nucleotide in sequence 3 was changed to a Cytosine? If it already was a Cytosine, w
Scrat [10]

Answer:

A point mutation with occur.

Explanation:

This quesiton might need more info but in general a point mutation will occur.

7 0
2 years ago
Choose all the answers that apply.
patriot [66]
Is caused by vibration, can travel through a vacum, and travels in longitudinal waves<span />
5 0
3 years ago
Read 2 more answers
The Rift Valley in Africa is an example of what type of plate motion?
elixir [45]
<span>A. The African plate is breaking apart to form two separate plates.</span>
5 0
3 years ago
How can I create a pundett square on mac
nirvana33 [79]
By going online and finding a punnet square program
4 0
3 years ago
All organisms are made of more than one cell
Nana76 [90]

That statement is false. Bacteria are single-celled organisms.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following body systems has the main function of sending signals from one part of the body to other parts of the bod
    11·1 answer
  • D. although protein was part of the composition of the foods in this experiment, it was not the main macromolecule component of
    7·1 answer
  • What is the state of matter of the lithosphere?
    9·1 answer
  • What can you infer about the wings of the bat and the butterfly?
    11·1 answer
  • The meninges is a three-layered, membranous covering of the brain and spinal cord. Read the descriptions below and then click an
    5·1 answer
  • Epithelial cells must be able to divide rapidly because they
    14·2 answers
  • 6. Two pink (Rr) flowers are crossed. (RR=red, rr=white)
    14·2 answers
  • Predators CANNOT Group of answer choices restrict the distribution of their prey. cause the abundance of their prey to rise. qui
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Helpppppppppppppppppppp
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!