1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
3 years ago
14

Which human activity would have the largest negative effect on biodiversity?

Biology
2 answers:
cluponka [151]3 years ago
6 0

Deforestation would have the largest negative effect on biodiversity. This is because it destroys habitats and can kill off species.

Vadim26 [7]3 years ago
5 0
Deforestation for resource mining or urbanization can displace native organisms.
You might be interested in
Not all cells are alike. Which of the following is NOT a true statement about differences between cells?
denis23 [38]

Answer:

D

Explanation:

without cell membrane there would be no cells. It's basically an organelle that makes a cell have it' name

3 0
3 years ago
Use what you know about the number of faces, vertices, and edges in polyhedrons to choose True or False for each statement.
inn [45]

Explanation:

1. A true statement

2. A false statement

3.A true statement

4.A true statement

3 0
3 years ago
The nurse is providing teaching to a client who is to begin taking oxybutynin for urinary incontinence
dolphi86 [110]

 

The nurse should first determine the prescribed dosage form of oxybutynin so he can instruct the patient on how to take the medicine. The tablet and syrup is usually taken two to four times every day with plenty of water with or without meal. While, the extended-release tablet is usually taken once a day and should not be cut, crush or chew. The drug should be taken at the exact time of the day.

<span>Moreover, advise the patient to continue taking oxybutynin even if he feel well and complete the whole duration of the prescription.  The patient should be careful especially when driving for oxybutynin may cause blurred vision. Follow the instruction label and the doctor order to achieve the therapeutic effect of the drug.  Lastly, if no improvement for the symptoms in 8 weeks, consult your doctor. </span>

<span> </span>

5 0
4 years ago
Mendelian inheritance states that traits are determined when offspring receive for each trait from . Traits can be , which means
vovangra [49]

Answers:

  • Mendelian inheritance states that traits are determined when offspring receive <u>alleles </u>for each trait from <u>Parents</u>.

Explanation:

As per Mendel, all the traits which are present in an offspring are determined by specific genes which exist in alternate forms called alleles. For example: The height of a plant is a trait which is determined by alleles T for tall height and t for small height of same gene. The organisms acquire these alleles from parents (one allele from each parent).

--------------------------------------------------------------------------------

  • Traits can be <u>Dominant </u>which means they can be seen and are capable of masking a different trait.

Explanation:

Dominant trait means when only a single dominant allele for the trait in an organism is enough for the organism to depict the trait. For example: In pea plant, purple flower color is a dominant trait over white. So any plant who contains only one dominant allele for purple (allele P) will have purple flowers but all plants that have two pp alleles will have recessive trait i.e White flowers.

-------------------------------------------------------------------------------------

  • Traits can also be <u>Recessive </u>which means they can be masked.

As mentioned in above example, white flower color of pea plant is a recessive trait. Recessive means that if a plant has one copy of recessive and one copy of dominant allele, the dominant allele will suppress or mask the effect of dominant allele. Example is the above case of flower color when a plant with genotype Pp will have purple but not white flowers.

-------------------------------------------------------------------------------------------

  • Alleles are different versions of the same <u>gene </u>in an organism.

Alleles are just alternate forms of a gene. For example if a plant height is determined by a gene L, it has two forms capital L and small l which are alleles of same gene. But capital L is for tall height and small l is for short height.


Hope it help!

3 0
3 years ago
Read 2 more answers
The relationship between two organisms in which one survives at the expense of the other is called
Zanzabum
I think its commensalism 
6 0
3 years ago
Read 2 more answers
Other questions:
  • Color blindness is a sex-linked recessive trait. A mother with normal color vision and a color blind father have a color blind d
    14·2 answers
  • A county commission is considering assessing a tax on residential water use above a certain amount. What might this tax be tryin
    12·2 answers
  • Sterile water is added to 2 grams of sodium chloride to make 100ml of solution.
    14·1 answer
  • Which b vitamin is especially important for women of childbearing age to prevent neural tube defects due to its importance in th
    12·1 answer
  • Which chemical reaction would result in the greatest release of energy?
    9·2 answers
  • What is the best definition for adaptation?
    6·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Can a cell live without nucleus?​
    8·1 answer
  • Cactus are adapted to live in deserts and other very
    13·2 answers
  • an organic molecule, smaller than protein, that contains nitrogen i think its a protein but im not sure
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!