1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
2 years ago
10

The symbols , -, and 0 are to be used to show the results of interactions between individuals and groups of individuals. The sym

bol denotes a positive interaction, - denotes a negative interaction, and 0 denotes where individuals are not affected by interacting. The first symbol refers to the first organism mentioned. What interactions exist between cellulose-digesting organisms in the gut of a termite and the termite?
A) +/+

B) +/-

C) 0/0

D) -/-
Biology
2 answers:
ad-work [718]2 years ago
3 0

Answer:

The correct answer is option A) "+/+".

Explanation:

Cellulose-digesting organisms in the gut of a termite and the termite itself have a positive interaction among them. The interaction among these organisms is classified as a symbiotic interaction because both organisms are benefited from it. Cellulose-digesting organisms in the gut of a termite obtain food and protection from the termite, and in return the termite is able to digest the cellulose of wood, its main source of food.

DIA [1.3K]2 years ago
3 0

Answer:

A) +/+

Explanation:

The form of interaction that exist between cellulose-digesting organisms in the gut of a termite and the termite itself is a +/+ interaction.

<em>This is because the interaction of both organisms is beneficial to each of them. While the cellulose-digesting organisms are able to get their shelter in the gut of the termite, the termite benefits from the presence of these cellulose-digesting organisms by getting their cellulose-containing food materials digested by them.</em>

Hence, it is a mutually beneficial interaction.

Option A is the correct option.

You might be interested in
"tertiary structure of a protein is maintained by (list the interactions)"
erik [133]

<span>Protein tertiary structures are known to be a three dimensional structure of a protein with a single polypeptide chain (backbone) and one or more protein secondary structures known as protein domains.</span>

Tertiary Structure Interactions

1) Hydrophobic Interactions: they are non- covalent bonds and very important in the formation of tertiary structure. 

2) Ionic Bonds: the interaction of both positive and negative amino acids forms a bond that helps to stabilize the protein molecules. 

3) Hydrogen Bonds: this bond exit between the amino acid with hydrophilic side chain found on the surface of the molecules and water molecules in a solution.

4) Disulfide Bridges: it is a strong covalent bond commonly found between cysteine residues in close proximity space. 

7 0
3 years ago
Which is considered a scientific observation?
jasenka [17]

Answer:

Mahir noticed the plant he watered grew taller than those with less water

Explanation:in the process of the scientific method,an observation about an occurrence happens first before an hypothesis is formulated and tested .

Observation usually involves the the description of a phenomenon.

6 0
3 years ago
Read 2 more answers
Which of the following is NOT a
skad [1K]

Answer:

C. high construction costs

Explanation:

5 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
If there is not enough carbohydrate available in cells to allow the acetyl-coa to enter the citric acid cycle, it will be used t
saveliy_v [14]
<span>If there is not enough carbohydrate available in cells to allow the acetyl-CoA to enter the citric acid cycle, it will be used to make ketones. Acetyl-CoA is a molecule that is important in some biochemical reactions involving protein lipid and carbohydrate metabolism. It function to transport an acetyl group to the citric acid cycle or the Krebs cycle for it to be oxidized for the production of energy. Ketone can be produced and is regulated from the acetyl-CoA. The rate of the production of this substance  would increase during starvation or in other words there is less carbohydrates that is available in the body.</span>
7 0
3 years ago
Other questions:
  • 1. Heat always moves from an object of
    6·2 answers
  • We want to study how pH affects the growth of
    6·1 answer
  • Which culprit originates an allergic response and causes Juan to sneeze when he sniffs the morning glory flower?
    9·2 answers
  • Which of the following statements does not highlight a difference in eukaryotic and prokaryotic translation?
    10·1 answer
  • Which condition is a malignant tumor composed of blood-forming tissues of the bone marrow?
    9·1 answer
  • Water vapor releases energy and changes<br> to a liquid in the atmosphere.<br> what is this called
    15·1 answer
  • What are steroid hormones most similar to?
    7·2 answers
  • The human body ___________ (can/cannot) produce all the amino acids.
    9·1 answer
  • Monomer of _____ consists of a sugar backbone, phosphate group anabases.
    10·1 answer
  • Which of these would be a cause of an occluded front?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!