1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
7

When wine matures in wood, color, bouquet, flavor, and tannins are extracted from the inside surface of the tank or barrel. also

, ___________ and _____________ occur?
Biology
1 answer:
Leona [35]3 years ago
6 0
Oxygen dependent maturation of the wine

concentration of the wine when water evaporates is your answer .-.
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Binding of glucose to hexokinase causes a conformational change in the enzyme. This is an example of the __________ model of enz
irina [24]

Answer:

Binding of glucose to hexokinase causes a conformational change in the enzyme. This is an example of the<u> induce-fit </u>model of enzyme catalysis.

Explanation:

The induce- fit model is generally the most accepted theory for enzyme catalysis. This theory states that the active site of an enzyme is not always a perfect fit for a substrate. The substrate induces changes in the active site so that it can fit into the active site. This theory is contrary to the theory of lock and key model, which stated that substrates exist as a perfect match for particular active sites of an enzyme.

6 0
3 years ago
Explain how a human offspring 47 chromosomes could be produced
Reika [66]
If they were to be no separation <span>of a pair of chromosomes during meiosis resulting in formation of a sperm or ovum with 24 chromosomes instead of 23.</span>
4 0
3 years ago
If a ship is sailing on an ocean and it is 2:00pm at the prime meridian and 10:00 am on the ship what is the longitudinal locati
bonufazy [111]

Answer:

The longitude of the location of the ship is W

Explanation:

Here we have the time at the prime meridian as 2 pm while the time at the ship is 10 am. What this means is that the prime meridian is 4 hours ahead of the time of the location of the ship. Geographically, whenever a location is east of the prime meridian, it is ahead of the prime.

3 0
3 years ago
Plants use nitrogen in fertilizers for growth. However, much of the nitrogen goes unused. What is one direct outcome of this exc
Olin [163]
There are many environmental negative direct outcomes of unused excess nitrogen from nitrogenous fertilizers. One of these is eutrophication. Eutrophication is the excessive richness of nutrients in a water body as a result of fertilizer run offs from the land, which causes a dense growth of plants in the water. Other negative outcomes are: green house effects, acid rain and contamination of underground water which has negative effects on human health. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which is usually the best way to present or communicate inferred data
    12·1 answer
  • How is this stratified squamous epithelium different from that observed in the esophagus?
    9·1 answer
  • What is the main function of structural adaptations? A. They help the organism survive in its environment. B. They help the orga
    14·1 answer
  • Which part of your curriculum does this lesson relate?
    14·1 answer
  • Cystic fibrosis is a genetic disorder in homozygous recessives that causes death during the teenage years. If 9 in 10,000 newbor
    9·1 answer
  • What are the four types of tissues found in the human body and what are the primary functions of each one.?
    11·1 answer
  • What genes control cell differentiation during development?
    14·1 answer
  • Can someone help me pls
    12·2 answers
  • Hey guys whats up hows it going
    13·1 answer
  • you fuse a sequence that contains a short stretch of hydrophobic amino acids to the c-terminus of gfp.you monitor this protein b
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!