1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentinak56 [21]
2 years ago
11

2. What is the most common element in the products you investigated?​

Biology
1 answer:
Gwar [14]2 years ago
8 0

Answer:   oxygen

Explanation: It is oxygen because we always need oxygen for many things and organisms

You might be interested in
This chart shows the amount of daylight that four cities get in January and July.
umka2103 [35]
Answer is c just took the test
5 0
2 years ago
What's portal of entry?
erik [133]
A portal of entry<span> is the site through which micro-organisms enter the susceptible host and cause disease/infection. Infectious agents enter the body through various </span>portals<span>, including the mucous membranes, the skin, the respiratory and the gastrointestinal tracts.</span>
6 0
3 years ago
Which plants produce leaves? (Select all that apply.)
m_a_m_a [10]

Answer:

B. Gametophytes of seedless vascular plants

4 0
3 years ago
Read 2 more answers
Plz Help Me Will make brainliest if got it right!!!
Rina8888 [55]

Answer:

Sorry if I'm wrong but I think it's B

Explanation:

A population bottleneck or genetic bottleneck is a sharp reduction in the size of a population due to environmental events such as famines, earthquakes, floods, fires, disease, and droughts or human activities such as specicide and human population planning.

6 0
2 years ago
Read 2 more answers
Should you see signs of microbial growth in a sterile medium if you allow it to incubate for several days
frozen [14]

No, even after several days of incubation, you shouldn't detect any symptoms of microbial growth in a sterile medium.

<h3>What is the microbial growth in the sterile medium?</h3>

The deliberate introduction of germs into a sterile growing medium is known as immunization. When there are no living creatures present, a substance is sterile; undesirable bacteria are said to be contaminated. The use of aseptic procedures helps keep growing media from being contaminated. Reduce the amount of time that cultures and growth media are exposed to the outside world. Clean the work area both before and after each use. Avoid breathing or touching the stock cultures or sterile culture media. Before used, loops, needles, pipes, and other items should be sanitized. The tube caps should be held in your hand while inoculating and not placed on the table while using tubes.

Learn more about microbial growth here:

brainly.com/question/14732566

#SPJ4

5 0
1 year ago
Other questions:
  • I’m very confused someone please help me:)
    14·2 answers
  • When you drive through a construction zone, you should:?
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The final product of the calvin-benson cycle used to produce glucose is _____.
    9·2 answers
  • Some species of organisms can reproduce either asexually through mitosis or sexually, which requires meiosis. In which of the fo
    7·2 answers
  • Which fungi group has members that possess centrioles?
    8·2 answers
  • Respiratory function deteriorates as a result of pneumonia because inflammationA) causes fluids to leak into the alveoli.B) caus
    9·2 answers
  • Our Sun will eventually become which of the following?"
    10·1 answer
  • Why might someone want to have smoke in the air at a laser show
    10·2 answers
  • Help? It’s ok if not but I really need it &lt;333
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!