1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
joja [24]
3 years ago
14

B. Why is there a huge demand of professionals in the field of agriculture​

Biology
1 answer:
Charra [1.4K]3 years ago
3 0

Answer:

There is an increase in demand for higher quality and quantity of food and other products.

Explanation:

There is an increase in demand for higher quality and quantity of food and other products. So, there is a huge requirement for technological innovation.  Investment is needed in research and development to develop crops that are pesticide-free, resistant to disease, and able to face various weather conditions.  Vertical farming and carbon-capture technology can be used to meet growing world food demands.

You might be interested in
Arteriolar blood pressure increases in response to all but______
NemiM [27]

Answer:

falling blood volume

Explanation:

3 0
3 years ago
Which criteria should materials of a technological design meet ?
WINSTONCH [101]
It must be durable and available
8 0
3 years ago
Read 2 more answers
Name the category of pathogen that causes athletic foot, influenza, strep throat, and malaria
topjm [15]
They probably fall into the bacteria catagory

3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Process by which plant and animals cells convert glucose into ATP energy to power the cell
mrs_skeptik [129]

Answer:

This process is photosynthesis!

Explanation:

Hope this helps!! <3

6 0
3 years ago
Other questions:
  • Can anybody please help me with krab cycle
    12·1 answer
  • Why does the Owl Butterfly have a pattern of an owls face on it's wings
    10·2 answers
  • Predators of different species competing for the same prey is which type of competition?
    13·1 answer
  • If a mutation creates a new fur color in a wolf population, what factor might determine whether the frequency of the new trait w
    9·2 answers
  • Summarize what biological organization means
    10·1 answer
  • Which vitamin is synthesized by microbes in the intestine and helps to maintain bone health
    10·1 answer
  • Why are upwellings more productive than downwellings?
    14·1 answer
  • Which of the following is a system of organs that collects oxygen from the external environment and transports it to the bloodst
    11·1 answer
  • How fast can you answer correct..? How fast can i give you brainliest. Explain Your answer:D/ HELP..............................
    5·2 answers
  • The Products (molecules on the right side of a chemical equation) of Aerobic Cellular Respiration are __________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!