1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
2 years ago
9

I NEED HELP ASAP (WILL MARK BRAINLIEST IF ITS THE RIGHT ANSWER) which of the following describes asexual reproduction

Biology
2 answers:
vodka [1.7K]2 years ago
6 0

Answer:grab the walls bby girl

Explanation:

Lolololol

Mekhanik [1.2K]2 years ago
5 0

<em>B. One parent organism and no egg or sperm.</em>

Explanation:

In asexual reproduction, an organism can produce offspring with no gametes involved (eggs or sperm), and does not need to undergo meiosis.

If an organism produces offspring through asexual reproduction, all of the DNA from the parent will go to the offspring. Since there is only one parent, meiosis will not occur since there is no need for genetic differentiation.

All of the organisms produced by the parent during asexual reproduction will be identical to the parent. They will have the same DNA and genetic make up.

You might be interested in
Give two differences between permanent and merystamitic tissues​
emmasim [6.3K]

Answer:

Permanent tissue consist of more than one time of cell and all are differeniated but meristemic tissue consist of undiffereniated cells.

Meristemic cells are simple but permanent cells are complex in nature.

Meristamic cell responsible for primary and secondary growth and permanent tissue helps in overall growth of plants

Explanation:

4 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Which statement best describes an important process carried
qwelly [4]

Answer:

2 materials are exchanged between fetal and maternla blood

Explanation:

i just took this test and this was correct

4 0
2 years ago
If three parallel lines are cut by a transversal and one angle is measured to be 90°, what can be said of the remaining angles?
BARSIC [14]
They're all 90 degrees 
8 0
3 years ago
Here is a model of Earth's yearly orbit around the Sun. In this model, the names of the seasons apply only to the northern hemis
Usimov [2.4K]

Answer:

D

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • THIS IS PLANT SCIENCE BTW !!! A source of healthy, locally grown food for the population of a given area :
    7·1 answer
  • Biology lesson 1.05 how do i do the chart flvs
    9·1 answer
  • How dose land use change as the human population increases
    7·2 answers
  • Can't figure this one out.
    14·1 answer
  • The native range of a species includes all areas in ahich it lives
    10·2 answers
  • If a woman has had a intercourse, and she missed a menstrual period by more than 14 days, she probably is pregnant. True or Fals
    6·2 answers
  • In bacteria, single polycistronic mRNA encodes for:
    10·1 answer
  • A chemical reaction occurs. Which of the following would indicate that energy is transformed during the reaction?
    15·1 answer
  • Where on the food chains are crocodiles
    6·2 answers
  • Both transcription and DNA replication produce nucleic acids which are polymers of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!