I NEED HELP ASAP (WILL MARK BRAINLIEST IF ITS THE RIGHT ANSWER) which of the following describes asexual reproduction

Biology

2 answers:

vodka [1.7K]2 years ago

6 0

Answer:grab the walls bby girl

Explanation:

Lolololol

Mekhanik [1.2K]2 years ago

5 0

<em>B. One parent organism and no egg or sperm.</em>

Explanation:

In asexual reproduction, an organism can produce offspring with no gametes involved (eggs or sperm), and does not need to undergo meiosis.

If an organism produces offspring through asexual reproduction, all of the DNA from the parent will go to the offspring. Since there is only one parent, meiosis will not occur since there is no need for genetic differentiation.

All of the organisms produced by the parent during asexual reproduction will be identical to the parent. They will have the same DNA and genetic make up.

You might be interested in

Give two differences between permanent and merystamitic tissues

emmasim [6.3K]

Answer:

Permanent tissue consist of more than one time of cell and all are differeniated but meristemic tissue consist of undiffereniated cells.

Meristemic cells are simple but permanent cells are complex in nature.

Meristamic cell responsible for primary and secondary growth and permanent tissue helps in overall growth of plants

Explanation:

4 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved