Answer:
Permanent tissue consist of more than one time of cell and all are differeniated but meristemic tissue consist of undiffereniated cells.
Meristemic cells are simple but permanent cells are complex in nature.
Meristamic cell responsible for primary and secondary growth and permanent tissue helps in overall growth of plants
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
2 materials are exchanged between fetal and maternla blood
Explanation:
i just took this test and this was correct