1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
2 years ago
15

All living organisms are classified into one of three domains: Bacteria, Archaea, and Eukarya. Compare and contrast the domains

Bacteria and Archaea. How are they alike? How are they different?
A) They are both composed of prokaryotic organisms. Bacteria are parasites and Archaea are free-living.
B) Both domains contain parasitic organisms composed of one cell. The Archaea are the disease-causing parasites.
C) They are both composed of prokaryotic organisms. The Archaea live in very extreme environments, like hot springs, but the Bacteria do not.
D) Both are unicellular, prokaryotes. The Archaea live as parasites while the Bacteria live in extreme environments, like the Salt Flats and Hot Springs.
Biology
2 answers:
Musya8 [376]2 years ago
7 0
C. The answer should be c, seeing as how bacteria die under high heat.
melamori03 [73]2 years ago
4 0

Answer:

The most appropriates answer would be C) They are both composed of prokaryotic organisms. The Archaea live in very extreme environments, like hot springs, but the Bacteria do not.

Archaea are prokaryotic unicellular organisms that is, they lack well defined nucleus. However, they have distinct chemical or molecular characteristics which differ them from the bacteria.

These organisms were originally discovered in extreme conditions such as hydrothermal vents. They can survive in diverse range of high acidic, saline, and anaerobic environment. They are also termed as extremophiles.

On other hand, bacteria are also prokaryotic unicellular organisms. They can inhabit in any area including air, water, soil, decaying organism et cetera however, they are usually not found in such extreme conditions in which archaea can survive.

For example, <em>Pyrolobus fumarii</em> can survive even at 113 °C  temperature.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
In which phase does a cell spend most of its time?
Mnenie [13.5K]

Answer:

a

Explanation:

4 0
3 years ago
Read 2 more answers
What is the difference between predator and prey relationships and symbiotic relationships?
Gwar [14]

Answer:

Symbiosis is any type of interaction between two different species of living things in the same environment. A predator-prey relationship is between two animal species —one kills and eats the other. ... Commensalism is an interaction benefiting one organism, and neither benefiting nor harming the other.

Explanation:

4 0
3 years ago
What happens during evaporation? water falls from the atmosphere to the ground water vapor changes into a liquid and forms cloud
motikmotik

Surface water changes into a gas and enters the atmosphere.

5 0
3 years ago
Consider the scenarios described below. Match the concept described by the scenario with the theory.
astraxan [27]

Answer:

1 - natural selection

2 - uniformitarianism

3- inheritance of acquired characteristics

4 - catastrophism

Explanation:

1. Natural selection refers to the evolution of organism or changes in the characterstics of organism depending on the environmental conditions. Hence, the lizard moved on fantasy island evolved with larger head and stronger bites as per the environmental condition.

2. The concept of Uniformitarianism states that the natural geological processes happening in present have already occured in past with same intesity and rate. Hence, geologist uses the phrase "The present is the key to the past" for  formation of mountain, rock formation and water movements.

3. Inheritance of acquired characteristics are the characteristic acquird by the ancestors and transmitted that gradually acquired characteristic to their progeny. Hence, the rats acquire the charactieristics and transfered it to the next generations.

4. Catastrophism means the regular occurrence of meteorological and geological disturbances to explain the existence the fossil record. Hence, teh mass exticiton due to asteroid impact is an example of Catastrophism.

So, the correct options in sequential order is natural selection, uniformitarianism, inheritance of acquired characteristics, and catastrophism.

3 0
3 years ago
Other questions:
  • Which essential fatty acid is rarely found to be deficient as it is typically consumed in abundance in the majority of diets?
    6·1 answer
  • Which of the following factors does not influence the level of the water table? a. pumping b. time of year c. pollution d. none
    11·2 answers
  • A client with major depression is frequently irritable, abrasive, and uncooperative and refuses to participate in group activiti
    8·1 answer
  • What term describes the behavior of an animal which warns another that a predator is approaching
    12·1 answer
  • When a comet nears the sun what happens to its nucleus
    10·2 answers
  • NEED HELP DUE TODAY PLZ HELP ME I AM STUCK PLZ PLZ PLZ HELP ME!!!!
    9·2 answers
  • 2. Which of the following states of water are described in the passage?
    6·2 answers
  • Which of these questions BEST summarizes the research described?
    6·2 answers
  • How does cellular differentiation benefit complex organisms?
    11·2 answers
  • You are researching a population of moles. In the course of your research, you identify a nearby population that occasionally co
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!