1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
6

Select all that apply.

Biology
2 answers:
weqwewe [10]3 years ago
6 0
Your answer is all of the above
yawa3891 [41]3 years ago
4 0
After the fossils are buried in the mud the soft tissues start to decompose rapidly. Leaving only the hard shells or bones of the animal. With time, sediment starts to build up on the top and then hardens into rock. The bones then start to decay, minerals start to enter and then end up replacing the organic material cell by cell in a process that is known as "petrification." So the answer you are looking for is B,  Mud can prevent oxygen from reaching the dead organism.
You might be interested in
Examples of electric fields in science
kkurt [141]
Some examples of electric fields in science are light, X- rays, radio waves, microwaves, etc.
7 0
3 years ago
Read 2 more answers
Arteriosclerosis is characterized by
Sav [38]

Answer:

E. thickening of the tunica intima and loss of elasticity in the tunica media.

Explanation:

Arteriosclerosis is characterized by thickening of the tunica intima and loss of elasticity in the tunica media.

4 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What was the Court’s decision in United States v. Nixon (1974) and how did the decision uphold the idea that even the President
vladimir1956 [14]

Answer:

The Supreme Court decided that the President was required to turn over tape recordings and other materials that had been subpoenaed by special prosecutor Leon Jaworski.

In trying to withhold some materials related to the Watergate investigation, Nixon's lawyer had argued that the President of the United States "is not subject to the processes of any court in the land except the court of impeachment." The Supreme Court disagreed, in unanimous fashion. They held that the President could not use executive privilege as an excuse for hiding wrongdoing or avoiding prosecution. In an interview some years after his resignation, Nixon still held to his view, claiming that when the President does something, "that means that it is not illegal." He felt that being in the position of President put him above the law. But the Supreme Court had firmly disagreed. They rejected the idea of "absolute, unqualified Presidential privilege of immunity from judicial process under all circumstances." Executive privilege can only protect matters of military or diplomatic confidentiality

5 0
2 years ago
In which order are the steps of the scientific method commonly listed
nikdorinn [45]

Answer:

1. Ask a question

2. Make a hypothesis

3. Conduct experiment

4. Make observations and record them

5. draw conclusions

6. write a conclusion

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why do birders check the progress of the bird count
    10·1 answer
  • The cycle repeats when the carbon stored in the atmosphere as carbon dioxide gas is taken in
    7·1 answer
  • Progressive muscle relaxation suggests that tension and relaxation are not mutually exclusive.
    11·1 answer
  • Which biome dominates the eastern region of the United States? A)grassland B)Temperate broadleaf forest C)scrubland D)desert
    15·1 answer
  • Which of the following pairs is most closely related?
    7·1 answer
  • When objects of two different temperatures come into contact, energy is transferred between the two objects from the object of h
    15·1 answer
  • Which is usually the best way to present or communicate inferred data?
    11·2 answers
  • Which phase of the cell cycle comes before the prophase stage of mitosis? (1) Anaphase
    11·1 answer
  • MICROBIOLOGY QUESTION!!
    10·1 answer
  • How are primary and secondary succession similar and how are they different?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!