1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
8

4. Cats have a gene that codes for the color of their fur. Suppose that a certain breed of cat can have black, gray, or white fu

r. Black fur is dominant, white fur is recessive, and gray fur is intermediate (i.e., cats with gray fur possess one allele for black fur and one for white fur). If a gray cat and a white cat have kittens, what phenotypes could the kittens exhibit •
A) black, gray, or white fur •
B) only gray fur •
C) black or white fur •
D) gray or white fur

Biology
2 answers:
Ivanshal [37]3 years ago
8 0

Answer:

D) gray or white fur

Explanation:

Suppose the gene for fur color has alleles B and b. Here, B imparts black fur while b gives white fur. Since B is incompletely dominant over b, the heterozygous genotype "Bb" would give intermediate gray fur. Hence, the cross between gray (Bb) and white cat (bb) would give progeny in 1 gray: 1 white ratio.

oksian1 [2.3K]3 years ago
4 0
D) gray or white fur
∈∈
You might be interested in
A research scientist writes a paper on the initial regrowth of a forest after a fire has damaged the entire ecosystem. Which tit
algol [13]
The Regrowth after Fire
7 0
3 years ago
Which process involves the body maintaining homeostasis? *​
oee [108]
An example of homeostasis would be sweating when the temperature is hot.
5 0
3 years ago
Which statement id true about a cell wall but not a cell membrane
Andru [333]

It forms the outer layer of a cell. It gives an animal cell its shape. It is selectively permeable.

:3333333333

3 0
3 years ago
Which of the following is an adaptation? *
balu736 [363]
A frog whose skin looks like the environment in which it lives
7 0
3 years ago
Think of examples of how the following parts of natural selection exist within mice populations:
Dovator [93]

Answer:

Overproduction i think

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • A marine scientist measures the energy found in a system consisting of seagrass and sunlight. After the seagrass grows for one w
    14·1 answer
  • In a certain population of rabbits, the allele for brown fur is dominant over the allele for white fur. If 10 out of 100 rabbits
    14·1 answer
  • What is the term for the amount of time it takes 50% of an element to decay
    13·1 answer
  • Cells that secrete mineral deposits that form bone are called_________.
    15·1 answer
  • An adolescent girl who participated in unprotected intercourse requires an emergency contraception. which drugs could be prescri
    9·2 answers
  • A planet has an orbital period of 3.24 years . What is the average distance of the planet from the sun? A.2.19
    6·2 answers
  • List, in order, the tRNA anticodons that are complementary to the mRNA sequence <br> AUGCAUGCAAGUUAG
    7·1 answer
  • Base your answer on the chemical equation shown in the diagram below and on your knowledge of biology.
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Explain why atmospheric concentrations of carbon dioxide are expected to increase in the future.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!