1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
9

When did the ocean become an important area of study?

Biology
2 answers:
alex41 [277]3 years ago
8 0
The answer is D. about 200 years ago
Lubov Fominskaja [6]3 years ago
4 0
D. Around 200 years ago
You might be interested in
What is competition between different species called
Troyanec [42]

Answer:

Competition between individuals of different species is known as interspecific competition.

8 0
3 years ago
How do photoautotrophs make energy?
Maslowich
The make energy from sunlight through photosynthesis.
5 0
2 years ago
Which structure is continuous with the very delicate corneal epithelium that covers the surface of the cornea? which structure i
DENIUS [597]
Ocular Conjunctiva  - It is a part of the conjunctiva, which is a clear membrane that covers the eye's surface. It is also called as the bulbar conjunctiva. The main function of the Ocular Conjunctiva is to protect the eye from germs and infections.
8 0
3 years ago
how does the temperature change in the suns atmosphere differ from the temperature change in the suns interior
Alexeev081 [22]
Photosphere - The photosphere is the deepest layer of the Sun<span> that we </span>can<span> .... </span>sun's temperature changes<span> throughout the layers of its </span>atmosphere<span>, we </span>can<span> then order .... generated in the </span>sun's interior<span>affect its lower </span>atmosphere<span>, or chromosphere, .... of the two wave motions, showed a time delay, known as a phase </span>difference<span>.</span>
8 0
3 years ago
What is a cell made out of
slega [8]

Answer:

Two-thirds of a cell is water, which means that two-thirds of your whole body is water. The rest is a mixture of molecules, mainly proteins, lipids and carbohydrates.

5 0
3 years ago
Other questions:
  • If the concentration of sodium is greater outside a cell than inside the cell, which process could move sodium out of the cell?
    5·2 answers
  • What cover the nucleus of a cell
    13·2 answers
  • The compound Fe2O3 contains how many atoms?
    5·2 answers
  • What structure inside the cell is most similar to the digestive system in humans ?
    7·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The attatched image has the questions, Zoom in to read if necessary.
    12·1 answer
  • I will Give Brainliest To Whoever Gets This Right!!!!!!!!!!!!!!!!!
    7·1 answer
  • What patterns do seismographic (earthquake) data reveal?
    15·1 answer
  • Chromosomes are made up of (a) DNA (b) Protein (c) DNA and protein (d) RNA answer fast plzzz
    11·1 answer
  • The _______ zone includes the alveoli, while the _______ zone includes the trachea.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!