1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
7

Pamela has started to take antibiotics, which kills most of the helpful and harmful bacteria in her body. Her doctor suggested s

he eat yogurt containing helpful bacteria to reestablish the bacteria in her digestive tract. Why is this important?
1. Bacteria are important to fight off diseases and infections.
2. Bacteria that live in the large intestine provide some vitamins to people.
3. Bacteria break food down into chyme, which is then digested.
4. Bacteria aid in the reabsorption of water in the large intestine.
Biology
1 answer:
Brut [27]3 years ago
3 0

Answer:

a

Explanation:

You might be interested in
Pure rain egg yolks battery acid and milk are all examples of acids
aleksandr82 [10.1K]

Answer:

TRUE

Explanation:

7 0
3 years ago
Is pawpaw a local food crop
Volgvan

Answer:

Pawpaw means papaya. Hope you'll get some clues from here

4 0
2 years ago
What does bone marrow produce?
joja [24]
The answer would be Option D: more bone
6 0
3 years ago
Read 2 more answers
What is shown in the image
seraphim [82]

Answer:

A cell

Explanation:

Could be an animal cell.

Best regards

7 0
3 years ago
Read 2 more answers
Cellular is all of the chemical reactions in cells
murzikaleks [220]

Answer:

(all cells) Sum of all the chemical reactions that take place in the body, consisting of anabolism and catabolism.

Explanation:

5 0
3 years ago
Other questions:
  • Answer the password
    5·2 answers
  • Which of these occurs during both photosynthesis and cellular respiration?
    13·2 answers
  • Which of the following was one of the purposes of the Gemini project?
    6·2 answers
  • When organisms ingest food, the food is converted into which substance?
    10·1 answer
  • Two proteins associated with a rare neurodegenerative disorder have been sequenced. Protein A contains many polar amino acids wi
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Does anyone know a Patrick Hearn that lives in Bergman Arkansas? Please, if you do let me know, and let him know im looking for
    11·2 answers
  • What is the mass of a box accelerating at 3 m/s^2 applying 36 N of force? Hint: Mass = force / acceleration​
    13·1 answer
  • How do individual’s affect environmental systems?
    10·2 answers
  • True or false? Vegetable oils are part of a balanced diet.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!