1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
3 years ago
14

The distance east and west from the prime meridian

Biology
2 answers:
Molodets [167]3 years ago
4 0
Longitude is the imaginary line that runs from the east to the west and thus, is the distance between the two. Latitude, however, is the line that runs from north to the south. The prime meridian is at zero degrees longitude. It<span> runs through the United Kingdom, France, Spain, western Africa, and Antarctica</span>
larisa86 [58]3 years ago
4 0

Longitude is the imaginary line that runs from the east to the west and thus, is the distance between the two. Latitude, however, is the line that runs from north to the south. The prime meridian is at zero degrees longitude. It runs through the United Kingdom, France, Spain, western Africa, and Antarctica

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Why can polyploidy individuals lead to speciation fairly quickly?
nekit [7.7K]

Answer:

In species with polyploid, there are more chromosomal sets than in diploid one. Becouse there are more chromosomal structures available,  events like mutation, recombination, DNA lose, are more probable to occur.

As the generations pass, the accumulation of these changes tend polyploid to speciation.

8 0
3 years ago
Which two kinds of information can scientists gather using radar?
makkiz [27]

The correct answers are C. Amount of rainfall, and D. Wind speed.

Explanation

Radars are instruments that were created by humans to detect objects, people, places, among others, through signals. Radars are devices used in different fields such as war, aviation, climatology, geography, among others. One of the best known is the Doppler radar, which is a climatological tool that is used to detect the intensity, size, quantity, and direction of rainfall. Likewise, rainfall is influenced by the direction and speed of the wind, data that can also be obtained using this tool. One of the purposes for which this object was created was the early detection of natural phenomena related to rains, and winds such as hurricanes, electric storms, hail, among others. Therefore, the two objects that scientists can obtain with a radar are C. Amount of rainfall, and D. Wind speed.

4 0
3 years ago
Which description is an example of codominance
xxMikexx [17]

Answer:

Explanation:

Codominance means that neither allele can mask the expression of the other allele. An example in humans would be the ABO blood group, where alleles A and alleles B are both expressed. So if an individual inherits allele A from their mother and allele B from their father, they have blood type AB.

3 0
2 years ago
The main goal of science is to _____.
Gelneren [198K]
Understand the world around us.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The incidence of down's syndrome increases with the age of the mother. <br> a. True <br> b. False
    13·1 answer
  • Neurons _____.
    13·2 answers
  • What are the correct steps in the transformation of a sedimentary rock into a metamorphic rock? rock eroded away and deposited i
    11·1 answer
  • A geneticist crossed pure breeding black mice with pure breeding brown mice. All the 992 mice in F1 generation had black coats.
    13·1 answer
  • an animals internal body structures can either be coelomate aceolmate or pseudocoelomate this means they may or may not have
    8·1 answer
  • Which group consists entirely of organic molecules
    7·1 answer
  • How would an increasing shark population most likely affect this ecosystem?
    6·1 answer
  • A herbicide is a chemical that kills plants. Which best describes the effect of a herbicide being
    7·2 answers
  • Small fish find shelter amongst the branching coral.
    10·1 answer
  • Scientists once believed that modern-day reptiles were the only living descendants of dinosaurs, which were reptiles. Accumulati
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!