1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dennis_Churaev [7]
3 years ago
10

Please I need help with this question ASAP:

Biology
1 answer:
frosja888 [35]3 years ago
4 0

Answer:

Explanation:

After having a carbohydrate rich meal concentration of some hormones, especially insulin change in your body. Insulin promotes the uptake of glucose by cells(particularly muscle cells, adipocytes, liver cells). It also increases the rate of glycolysis and glycogenesis and decreases the rate of gluconeogenesis and glycogenolysis.

These important metabolic pathways cause burning up glucose to make ATP that all cells in our body need and also storing it in the form of glycogen in the liver which is a very important food storage. Metabolism of carbohydrates also causes fat to be deposited in adipocytes which is basically why we have stuff like keto diets(no or very little carbohydrates and mainly fats consumed) for losing weight!

You might be interested in
2. What happens in<br> terms of energy<br> when you hold a<br> craft stick and bend<br> it slightly?
gizmo_the_mogwai [7]

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

3 0
4 years ago
Earth's second atmosphere (atmosphere ii) was produced primarily by which process?
Natasha2012 [34]
<span>The second atmosphere was formed by outgassing. This means that volcanic eruptions that released CO2, N2O, and H2O aided in forming this atmosphere. The gases, that come from the melting of the Earth's crust, were released into the air after the volcanic activity.</span>
4 0
3 years ago
Which statement best explains the differences between the cells?
bija089 [108]
I think A in am not a 100%sure tell me if I am wrong.
3 0
4 years ago
The volume of a solid can be expressed in units of cm3?True or False
vodomira [7]

Answer:

The answer is True.

3 0
4 years ago
A ________ is the space between two neurons where the axon of a sending neuron communicates with the dendrites of a receiving ne
Arada [10]

Answer: Synaptic gap

A synaptic gap is the space between two neurons where the axon of a sending neuron communicates with the dendrites of a receiving neuron by using chemical messages.

Explanation:

Neurons are joined end to end in a special way, the axon of one neuron forms a junction with the dendrites of the next neuron. However, the two neurons do not touch, but leave a gap called synaptic gap.

Thus, synaptic gap is the answer.

3 0
3 years ago
Other questions:
  • An object can be seen if the eye detects light that is...
    10·1 answer
  • If a plant cell contains more solutes than its surrounding environment, what will happen?
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What happens in the photosystem II protein when it is hit by a photon of light?
    11·2 answers
  • Shoud a patient with a history of smoking be moved to the top of the transplant list?
    5·1 answer
  • What implications need to be considered when creating environmental policies?
    10·2 answers
  • I the otter , sea urchin , kelp community , what trophic level is the kelp ?
    11·1 answer
  • 1. A. Read the following and choose the
    12·2 answers
  • The ______ ______ muscles contract to raise the hair shafts to use the body hair to trap heat
    8·1 answer
  • What is a double membrane that surrounds the nucleus in the cell ??
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!