1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavel [41]
3 years ago
10

The smallest unit into whicj a compoune can be divided and still be that same compound is a(n)

Biology
2 answers:
cricket20 [7]3 years ago
5 0

Answer:

LOL BRUH THIS IS THE FUNNIEST THING IVE EVER SEEN XDDDDD HE GO NAE NAE'D ON.

Explanation:

Tema [17]3 years ago
3 0
The answer is MOLECULE.
You might be interested in
QUICK HELP!!!!!!! Choose an organism that you are familar with, and explain how the three parts of the cell theory relate to tha
Lana71 [14]
You can pick any organism and relate most of the cell theory to them. For instance, all living organisms are composed of cells. This is part of the cell theory and all living organisms are just that, made of cells. Another part of the cell theory that can be applied to any organism is that hereditary information is passed on from cell to cell. When we have Offspring, we pass off our hereditary information to our offspring. Lastly, part of the cell theory states that cells arise from pre-existing cells. I was born from a mother and a father so as a human I exist because I came from another human.
3 0
4 years ago
The variety of life across the biosphere is called
marysya [2.9K]
I think biotic but im not sure
6 0
3 years ago
6. Which of the following describes the frozen underground soil that is found in the tundra a. polar ice c. permafrost b. hard f
jeka57 [31]
C. Permafrost


Permafrost is the layer beneath the "active layer". The active layer consists of soil that freezes and thaws every year. However, the requirement for permafrost is that it be frozen for two or more years consecutively. This is why permafrost exists in cold environments such as tundras.
6 0
4 years ago
When atp breaks down to adp, potential energy stored in bonds is released. this energy stored in bonds is __________ energy?
Mila [183]
Regenerate cells plants energy
6 0
3 years ago
Define los tipos de proteínas que conforman la membrana
tensa zangetsu [6.8K]

Membrane proteins can be classified into two broad categories—integral (intrinsic) and peripheral (extrinsic)—based on the nature of the membrane-protein interactions (see Figure 3-32). Most biomembranes contain both types of membrane proteins.

Translate:

Las proteínas de membrana se pueden clasificar en dos categorías amplias: integrales (intrínsecas) y periféricas (extrínsecas), según la naturaleza de las interacciones membrana-proteína (véase la figura 3-32). La mayoría de las biomembranas contienen ambos tipos de proteínas de membrana.

5 0
3 years ago
Other questions:
  • Describe when ozone is good and when it is harmful.
    14·1 answer
  • During high intensity exercise, lactate can be converted to which substance via the cori cycle?
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • White-headed woodpeckers are adapted to have strong beaks that can break into tree trunks to find bugs and can also open pine co
    12·2 answers
  • Healthy body composition is best characterized by
    7·1 answer
  • Please help me plz :(
    12·2 answers
  • Match the statements.​
    8·1 answer
  • What is natural selection?
    15·1 answer
  • The large size (volume) of African elephants make it challenging to get rid of heat. They live in a hotter environment than Indi
    14·1 answer
  • Which organelle of a cell functions similarly to the envelope of a virus and why?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!