1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
3 years ago
12

Earth is the center of the universe and everything revolves around it A) science B) Pseudoscience

Biology
1 answer:
ryzh [129]3 years ago
4 0

Answer:

The correct answer is - option B. peseudoscience.

Explanation:

Earth is the center of the universe and everything revolves around the earth is a theory known as geocentrism which is presented by the Ptolemy for the first time.

However, this theory is not based on true facts and logic and it is believed by the scientists, and environmentalists on the basis of observation that we are the only planet where life existed and half of the stars above the horizon and half the stars are below the horizon.

You might be interested in
Which of the following statements is true?
blagie [28]

Answer:

C. capillaries connect arteries and veins.

Explanation:

A is false, veins carry blood towards the heart.

B is false because arteries are the thickest blood vessel.

C is completely true

D is false, heartbeat is controlled by electric impulses

6 0
3 years ago
Read 2 more answers
Which of the following contributes to the desertification of the land?
Mrac [35]

Respuesta:

B. pastoreo excesivo de animales de granja

Porque son lugares secos.

Explicación:  

Las políticas e infraestructuras que promueven la agricultura en las tierras de pastoreo que no pueden mantener sistemas viables de cultivo, contribuyen a la desertificación. La mayoría de las áreas de tierras secas (el 65%) son tierras de pastoreo que son más adecuadas para el pastoreo sostenible que para el cultivo.

3 0
2 years ago
Read 2 more answers
A group of students is reviewing information about cast composition in preparation for a discussion on the advantages and disadv
san4es73 [151]

Answer:

Plaster cast is made up from dry muslin containing starch or dextrose and calcium sulfate.

Explanation:

It is applied to protect and  is immobilize an injured bone or joint because it provides rigidity.

It is also used to help the bone and joint from reduce pain that is created during movement.

When plaster becomes wet,it reacts (Between water and calcium sulfate) and produces heat that eventually sets the plaster.It becomes hard when it dries.

The color of plaster casts are smooth and white.

4 0
3 years ago
What species are humans furthest related to
denis23 [38]

Answer:

the comb jellyfish

hope it helps!

4 0
2 years ago
Eukartyotic cell are more complex than prokaryotic cell
Elis [28]

Answer:

Eukaryotic cells are generally larger and more complex than prokaryotic cells. They also contain a variety of cellular bodies called organelles. The organelles function in the activities of the cell and are compartments for localizing metabolic function.

Explanation:

8 0
1 year ago
Other questions:
  • Both mitosis and meiosis begin with a diploid cell that contains replicated chromosomes.
    8·1 answer
  • How do Salmonella bacteria in the gut microbiome affect the body?
    9·1 answer
  • Put the protein digestion steps in order of their occurrence during the digestive process.
    15·1 answer
  • Communication between cells tissues and organs blood component
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The first answer will be marked as the brainliest...
    5·1 answer
  • Can someone please tell me the main function of the excretory/urinary system? If you look it up online, could you also please pa
    10·1 answer
  • Which of the following statements describes the relationship between DNA and genes?
    13·2 answers
  • 1. All of these things are true about a theory except for..
    11·1 answer
  • Describe the ways in which water in sewage polluted lake and water from the sea are
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!