1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
3 years ago
5

What makes up the majority of the solar system? stars planets asteroids space

Biology
2 answers:
defon3 years ago
8 0

Answer:

The answer would be stars

Explanation:

Hope this helps :)

oee [108]3 years ago
4 0

Answer:

Our solar system is made up of a star, eight planets and countless smaller bodies such as dwarf planets, asteroids and comets.

Explanation:

By far most of the solar system's mass is in the Sun itself: somewhere between 99.8 and 99.9 percent. The rest is split between the planets and their satellites, and the comets and asteroids and the dust and gas surrounding our star.

You might be interested in
Compare and contrast DNA and RNA.
Marrrta [24]

Answer:

Thus, the major difference between DNA and RNA is that DNA is double-stranded and RNA is single-stranded. DNA is responsible for genetic information transmission, whereas RNA transmits genetic codes that are necessary for protein creation.

<h2>good morning friend </h2>

7 0
3 years ago
Read 2 more answers
What can be used to collect and record scientific data
Aneli [31]

Answer:

Case Studies, Checklists, Interviews, Observation sometimes, and Surveys or Questionnaires are all tools used to collect data. It is important to decide the tools for data collection because research is carried out in different ways and for different.

Explanation:

please mark me brainleast

3 0
3 years ago
How was the knowledge of ecological succession applied to the reclamation of land damaged due to mining?
Mandarinka [93]

After mining, to reclaim the land, the depression is filled with rocks then the top is filled with loosely graded soil. Introduction of early succession plants is important before big trees can grow. The early succession plants help in the breaking down of the rocks into soil hence making the topsoil deeper to support trees.  

6 0
3 years ago
Read 2 more answers
Choose the words that correctly fill in the blanks: Charles Darwin is known as the "Father of Evolution" because he proposed the
kakasveta [241]

Answer:

B.Evolution, natural selection

Explanation:

Charles Darwin is known as the "Father of Evolution" because he proposed the idea of evolution by way of natural selection.

3 0
2 years ago
Read 2 more answers
Which are examples of habitat destruction? Check all that apply.
Norma-Jean [14]
A,C,D are the answers. I took Biology.
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is the region where the respiratory path has to cross the digestive pathway?
    11·1 answer
  • How does temperature affect the amount of carbon dioxide that yeast cells produce
    8·1 answer
  • Since Eleanor’s brain processes incoming sensory stimuli less intensely than normal, she often gets hurt because she does not al
    11·2 answers
  • A method that uses a mathematical equation and the half-life of decay to determine the exact date of a fossil is known as
    8·1 answer
  • Which came first 1. Atlantic Oceans begin to form
    10·1 answer
  • In which phase of mitosis are chromosomes first seen as a result of chromatin coiling? prophase anaphase metaphase telophase.
    13·1 answer
  • Which state of matter has the most densely packed particles?<br><br> Gas, solid, liquid, or none?
    8·2 answers
  • A hot sun warms the surface of a lake on a calm day. What will happen to the cold water at the bottom of the lake?
    12·2 answers
  • 2. When the plastic sheet is pulled down (inhalation), what happens to the pressure in the plastic bottle?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!