1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andre45 [30]
3 years ago
7

Using a compound light microscope worksheet

Biology
1 answer:
QveST [7]3 years ago
7 0
If the microscope is lighter then a brick that means you have to multiply The two numbers In a row
You might be interested in
Assume that you are a marine biologist. Choose a marine phyletic group and write a report on its diversity and the adaptations
Maslowich

Answer:

These organisms should be adapted to live in this enviroment, i.e., they need to have adaptations to breathe, to swim (fins), streamlined bodies to move through the water, to eat the food found in the region, etc. Moreover, in this environment, the diversity tends to be high because marine regions are often characterized by their richness.

7 0
3 years ago
BRAINLIESTTT ASAP!!!!<br><br> -What is the position of Earth during its four seasons?
Keith_Richards [23]

Summer , for the northern hemisphere, summer is the warmest time of year. It's not because the planet is that much closer to the Sun, it's because the top part of the Earth is facing the Sun for a amount of time.

The Sun is directly over the Equator during the autumnal equinox, and heating the northern and southern hemispheres equally. As the northern hemisphere is moving towards shorter days and the cold winter, the southern hemisphere is watching the snows melt and the flowers bloom during their spring.

Summer is the season where the Earth is tilted way from the Sun and the South Pole is getting all of the light

Spring is a bit of a mirror image to our position in autumn. The Sun is directly over the Equator during the equinox and the northern and southern hemispheres

6 0
3 years ago
Read 2 more answers
Why are molecular clocks important in the construction of cladograms? They compare the frequency of reproduction to determine wh
Dmitrij [34]

Answer: They compare the number of mutations to determine how long ago species separated and evolved.

You're welcome!

7 0
3 years ago
Read 2 more answers
Which molecular activity requires a folded structure?
Mice21 [21]

B -  Because an active cell can only work if it has a 3-Dimension structure.

7 0
3 years ago
Adults do not need foods from the dairy group, only growing children and athletes do.
ankoles [38]
I don't think this is a question
4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What does this passage most likely reveal about how the characters view the situation?
    6·2 answers
  • Explain your interpretation of the fluid mosaic model for the cell membrane. Please
    11·1 answer
  • Based on the data collected, what must be added to the yeast in the test tube in order to facilitate fermentation?
    14·2 answers
  • All autotrophs produce valuable organic molecules. What makes these organic molecules so valuable to living organisms
    12·1 answer
  • Read the passage. Then explain the ways humans have influenced the traits in corn plants and the impacts each biotechnology has
    7·2 answers
  • What makes amino acids unique from one another?
    14·1 answer
  • What do wolves eliminate from the population?
    9·2 answers
  • What's the meaning of a pneumatic bones ?​
    12·2 answers
  • What makes an experiment a controlled experiment?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!