1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
11

Name 3 physiological processes of cell membrane?{3mks} plz help me guys

Biology
1 answer:
BARSIC [14]3 years ago
7 0

Answer:

the <u><em>cell membrane</em></u> is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

You might be interested in
Please order the layers of a cliff side by the age of fossils found there from youngest to oldest
aev [14]
Youngest to oldest would be: 3, 4, 1, 5, 2. Since it's from the bottom, the ones furthest from the bottom would be the youngest at the top. The oldest fossils would be closest to the bottom.
7 0
3 years ago
In a flowering plant, blue flower (B) trait is dominant to white flower (b) trait. A true-breeding blue flower plant (BB) is cro
scoundrel [369]

Answer: D. 100%

Explanation:

One parent is with is a true breeding blue flowering plants this means the two alleles of the genotype are homozygous dominant alleles (BB).

The other parent is a true breeding with flowering plant, this means the two alleles of the genotype are homozygous recessive alleles (BB).

When both parents are crossed, the possible genotype outcome is

B B  *  b b

Bb Bb Bb Bb

Therefore since the blue flowering plant allele (B) is dominant to the white flowering plant allele (b) the probability of an offspring outcome to be a blue flowering plant is 4/4 which is 100%.44

Answer is 100%

3 0
3 years ago
Read 2 more answers
A mutation would have an effect on _____ molecules.<br><br> Sugar<br> Amino acid<br> Lipid<br> Fat
Degger [83]

Answer: amino acids

A mutation is a single or multiple event which brings a change in a genetic material of the organisms. A mutation will alter a DNA base pair that causes deletion or substitution of one amino acid in a protein encoded by a gene.


4 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Where is the carbon taken in by plants during photosynthesis stored?
FrozenT [24]

Answer:

b

Explanation I took a test

6 0
3 years ago
Read 2 more answers
Other questions:
  • What type of biomolecule does photosynthesis make to store chemical energy?
    10·1 answer
  • What process results in two complete strands of DNA from one original strand?
    15·1 answer
  • 1. One of the products of cellular respiration is a reac
    7·1 answer
  • All of the following are considered earth sciences EXCEPT A) biology Eliminate B) geology C) oceanography D) geography
    15·2 answers
  • Which of the following was a function of the wetlands in Florida?
    11·2 answers
  • In a separate location, take notes from the sources you have identified. The notes will provide details for your paper. While ta
    10·1 answer
  • Confusin help pls ??????????
    10·1 answer
  • When an animal moves, which energy transformation takes place?
    15·1 answer
  • _______ bonds form when water is removed to hold
    8·2 answers
  • Is Neptune’s volume more than 100 times as large as earth
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!