1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
3 years ago
15

Why was the stethoscope invented?

Biology
1 answer:
koban [17]3 years ago
7 0
A



hope it is correct!!!!!!!!!!!!!!!!!!!!!!!
You might be interested in
Describe homeostasis and give one example of your body trying to maintain homeostasis
mezya [45]

Answer:

Homeostasis is to keep an internal environment stable and balanced. An example of your body trying to maintain homeostasis is when it is very hot outside and you sweat. Our integumentary system plays a role in this by regulating our body temperature.

Explanation:

7 0
3 years ago
Identify the major chromosomal abnormalities and their causes (eg. down's syndrome, turner's syndrome, klinefelter's syndrome, c
My name is Ann [436]
Chromosome defect lot of became syndrome.
it's lot of cause
8 0
3 years ago
What would happen if the cell membrane were completely made of a polar substance
Citrus2011 [14]

Answer:

the cell would not be able to produce vacuoles

6 0
3 years ago
Bacteria that may form endospores include A. E. coli.B. Pseudomonas and Micrococcus.C. Clostridium and Bacillus.D. Enterococcus
Degger [83]

Answer:

C. <em>Clostridium</em> and <em>Bacillus</em>.

Explanation:

<em>Bacillus </em>and <em>Clostridium</em> are the gram-positive bacteria and form endospores. Endospores are the resistant dormant structures formed by some gram-positive bacteria.

These bacteria form the endospores within their vegetative cells. The endospores are highly resistant to environmental stress conditions and make these bacterial genera the dangerous pathogens.

7 0
3 years ago
Signs and symptoms that a woman should report immediately to her health care p rovider include:________.
solong [7]

The question is incorrect.

the correct question is Signs and symptoms that a prenant woman should report immediately to her health care provider include:________.

a. vaginal bleeding

b. rupture of membranes

c. heartburn with severe headache

d. decreased libido

e. urinary frequency

Answer:

a. vaginal bleeding

b. rupture of membranes

c. heartburn with severe headache

Explanation:

A pregnant woman should report immediately about vaginal bleeding

, rupture of membranes

, and heartburn with severe headache to her health care provider.

<u>A) Vaginal bleeding: </u>vaginal bleeding is uterine bleeding, which is common in the earlier stage of pregnancy but if it is continous it can be symptoms of miscarriage, so one should immediately contact her healthcare provider.

<u>B) Rupture of membranes:</u> If any pregnant women experience rupture of membrane, it causes steady leakage of fluid from the vagina. If the rupture is preature it can cause some complications in the baby such as premature birth, infection, and cord compression.

<u>C) Heartburn with severe headache:</u> if a woman experiences heartburn with severe headache during pregnancy, she should immediately contact her healthcare provider as it can be symptoms of preeclampsia (condition develops during the second half of pregnancy).

Hence, the correct options are a) vaginal bleeding

, b) rupture of membranes

, and c) heartburn with severe headache

6 0
3 years ago
Other questions:
  • 100 points!!! Identify the Independent and Dependent variables based on the DDT Egg data table.
    9·2 answers
  • adding a bacterial cell to a liquid that has a high osmotic pressure would result in __________ A. no net change in water moveme
    6·1 answer
  • The sharp reduction of numbers of a population and with it the gene pool through a severe epidemic is an example of :
    7·1 answer
  • The termite gut protist, Mixotricha paradoxa, has at least two kinds of bacteria attached to its outer surface. One kind is a sp
    11·1 answer
  • After conducting genetic analysis of a newly found fossil of an early modern homo sapien, you find that several nucleotide seque
    7·1 answer
  • How many circulatory systems do dogs have?
    10·1 answer
  • True or false: alleles for the same trait are at different locations on homologous chromosomes​
    5·1 answer
  • Why are the models of solar systems that you can purchase in stores not to scale?
    10·2 answers
  • Question 12 (6 points)
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!