1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
2 years ago
10

Which organelle of a prokaryotic cell contains genetic information

Biology
2 answers:
disa [49]2 years ago
7 0
The chromosomal DNA contains genetic information and plasmid DNA contains extra information.
raketka [301]2 years ago
7 0

Answer:

Nucleoid is the region which is having irregular shape and contains the genetic material of the prokaryotes.

The genetic material can be defined as the hereditary material that is transferred from one generation to another generation carrying the important information.

As prokaryotic cell does not contains nucleus the DNA of prokaryotic cell is found in the nucleoid of the cell.

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Select all the advantages of a multienzyme complex over a metabolic pathway
Kazeer [188]

Answer:

Option A, B, C

Explanation:

The major advantages of multienzyme complex over a metabolic pathway is that it do not require individual pathway for each enzyme activation or inhibition. Instead it responds efficiently to the equilibrium changes of substrate supply and demand as compared to that of enzymes.

It tightly regulates the processes and is also faster than that of the metabolic pathway.

Hence, option A, B and C are correct

8 0
3 years ago
Dominic notices That his pool loses a little water each day and needs to be re-filled often in the hot Texas summer. What is the
slava [35]

Answer: The hot weather cases the cold pool water to evaporate.

Hope this helps! I didn't have much to work with sense you didnt give options :)

3 0
3 years ago
How much space is there between particles of frozen water?
denpristay [2]

Explanation:

When water turns to ice, it expands/contracts

The (molecules) in water is more tightly packed than in ice, so water has greater density than ice. Don't let the fact that ice is a solid fool you!

6 0
3 years ago
Widespread effect on the worldwide ecosystem are called ________?​
Mrac [35]

Answer:

global change

5 0
3 years ago
Other questions:
  • Explain dna is considered the hereditary material
    11·1 answer
  • describe two ways that the design of the pelamis wave power technology may help minimize effect to marine animals and migrating
    9·1 answer
  • What is an Otorhinolaryngologist
    14·1 answer
  • Identify the gland and hormone(s) affected by oophorectomy
    15·1 answer
  • How could competition play a role in the way populations change?
    7·1 answer
  • Knowing that chaparral biomes are comprised mostly of low-growing shrubs, what adaptations have sage, rosemary, thyme, and orega
    8·2 answers
  • Name an organism that acts as secondary<br> consumer and a tertiary consumer.
    9·1 answer
  • Estimate the length of time that it took for CO 2 to from 200 300 ppm
    13·1 answer
  • Reasons why a transport system is necessary in higher animals?​
    11·1 answer
  • The __________ adds fluid to sperm in order to nourish them and make the sperm more mobile.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!