1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
3 years ago
8

Which phrase describes elevation?

Biology
2 answers:
podryga [215]3 years ago
8 0

Explanation:

A-The height of a feature above sea level

mote1985 [20]3 years ago
3 0

Answer:

<u>A- The height of a feature above sea level</u>

Explanation:

Elevation is defined as "height above a given level, especially sea level."

You might be interested in
The word ecology is made up of two Greek words, oikos and logia, and means "_____." house knowledge life logic house logistics e
Gemiola [76]
The correct answer is:  [A]:  "house knowledge" . 
_________________________________________________________
Specifically, "<em><u>oikos</u></em>" means: "house" ; and "<em><u>logia</u></em>" means "knowledge" .
_________________________________________________________
8 0
4 years ago
Atoms May bond together to make larger what ​
Maru [420]

Atoms bond together to make larger molecules or elements.

5 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
A plastic rod becomes negatively charged when it is rubbed with a piece of wool. how does the rob become charged?
gavmur [86]
Electrons are being transferred to the rod therefore giving a negative charge
3 0
4 years ago
Black coffee has a pH around 5; hand soap has a pH of 10. How many times more acidic is coffee relative
Anon25 [30]

Answer:

\boxed {\boxed {\sf 10^5 \ or \ 100,000 \ times \ more \ acidic}}

Explanation:

The pH scale stands for the power or potential of hydrogen. It measures how acidic or basic a solution based on the concentration of hydrogen ions and a scale from 1 to 14.

This scale is unique because it is logarithmic. So, every time the pH changes by 1 on the scale, the actual concentration of the solution increases or decreases by a tenfold.

So, a solution with a pH of 7 is ten times more acidic than a solution with a pH of 8. This can be translated to:

10^ {difference \ in \ pH}

The black coffee has a pH of 5 and the hand soap has a pH of 10. We want to find how many times more acidic coffee is, so we subtract 5 from 10 and get 5. The difference in pH is 5.

10^5=100,000

Coffee is <u>10⁵ or 100,000 times more acidic than hand soap.</u>

3 0
3 years ago
Other questions:
  • Oxytocin, which is synthesized in the hypothalamus, is secreted into the circulatory system of the body via the:
    14·1 answer
  • The current rate of species loss is 10 times the typical rate of extinction true or false
    9·1 answer
  • 1) When biologists wish to study the internal ultrastructure of cells, they can achieve the finest resolution by using A) a phas
    12·1 answer
  • Which type of blood vessel serves as a blood reservoir?
    11·1 answer
  • according to the second law of Thermodynamics a system never yields as much energy as was put in. true or false
    7·2 answers
  • Let's say that in dogs, brown fur is dominant to yellow fur. Two dogs with brown fur mate and produce 10 offspring. Eight of the
    13·1 answer
  • The protein found in hair and nails is known as: enamel keratin lunula follicle
    6·2 answers
  • Which of the following statements is TRUE?
    12·1 answer
  • What are the “rungs” of the DNA ladder made of?
    12·1 answer
  • if plants need light to grow then plants in the shade will grow more slowly what is the student doing
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!