Yes, it is possible.
In this case both of the parental plants were heterozygotes and they manifested dominant allele in their phenotype, which is round seed.
P: Aa x Aa
F5: AA, Aa, aA, aa - possible genotypes in fifth generations.
A- dominant allele (round seeds); a- recessive allele (wrinkled seeds)
Wrinkled phenotype is manifested only if there are two recessive alleles present.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Wash your hands
Clean and sanitize surfaces
The liver is at a #3 level of organization, an organ..which has a specific job to do in the body.
Explanation:
The way the Cell cycle works helps us keep us alive as long as usually do. An example is when you bite your cheek, you may kill some cells by it but your alive cells will replace them by creating more. Now without the cell cycle here's what would happen, You bite your cheek and your cells die forever causing your mouth to be dryer, weaker and to lack enzymes ( enzymes help brake down your food and ready it to go threw your digestive system ) So imagine every time you get hurt and your cells just keep dying without being reborn that's like as if everyone stopped creating children eventually the human race would end, If the cell cycle does not do its job eventually you will get weak and die. that's why the Cell Cycle is important to any living things well being especially if its Multicellular.
Hope this helps! <3
