1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
8

A mature, unfertilized ovule in an angiosperm is the result of

Biology
1 answer:
dmitriy555 [2]3 years ago
3 0
Both meiotic and mitotic divisions.
You might be interested in
The polarity of water describes the unequal sharing of electrons. What can you expect to find in a water molecule?
Law Incorporation [45]

your answer is   A ionic bonds

7 0
3 years ago
Which event is caused by gravity with water
Bond [772]

Erosion is your answer

8 0
4 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Help me with this _XX
expeople1 [14]

Answer:

B. Hardness

Explanation:

Physical properties of a substance is defined as the properties which can be observed or measured without changing the composition of matter.

Physical properties include odor, appearance, color, texture, boiling point, melting point and many others.

Hardness is a physical property of a substance as it describes the  resistance of substance to deformation and can be observed by simple touch or without changing the composition of matter.

While reactivity, toxicity and flammability are chemical properties of substances that change one type of matter into another type.

Hence, the correct option is B.

5 0
3 years ago
Is this internal or external conflict? Mr. Farris’s letters to the editor of the local newspaper turned into a very nasty exchan
Finger [1]
Me I have to say external
8 0
3 years ago
Other questions:
  • Common rosefinches arrived in Hawaii roughly 6 to 7 million years ago and have since evolved into at least 56 new species of hon
    6·1 answer
  • What is the term for the two upper chambers of the heart?
    15·1 answer
  • What is the study of how living things interact with each other and their environment?
    10·1 answer
  • In which climate would you expect to find a plant with smooth, thick skin enclosing a gel-filled interior?
    13·1 answer
  • In an hiv-infected cell producing hiv virus particles, the viral glycoprotein is expressed on the plasma membrane. how do the vi
    15·1 answer
  • Sensory receptors adjust their response rates on the basis of the average amount of stimuli received, resulting in _____.
    5·1 answer
  • Which statements describe infectious diseases and pathogens? Check all that apply.
    8·2 answers
  • How many nuclei will be left after the second half-life?
    15·1 answer
  • If a telescope could zoom even further in, and look beyond the hdf , what do you think they would see?
    9·1 answer
  • Help
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!