1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wariber [46]
3 years ago
9

Name at least four other gases in the atmosphere besides oxygen and nitrogen

Biology
1 answer:
I am Lyosha [343]3 years ago
7 0

The air that we breathe is mostly made up of nitrogen (78%). 21% is oxygen which is needed for animals and humans in respiration and 0.03% is carbon dioxide which is needed for plants to make energy in a process called photosynthesis. The bit that is left is made up of rare gases like helium and argon and methane.
You might be interested in
How many chromosomes are present in the human cell nucleus? *
77julia77 [94]

Answer:

I believe D

Explanation:

4 0
2 years ago
Read 2 more answers
Which of the following describes stylistic techniques?(1 point)
Ilia_Sergeevich [38]

Answer:

the answer is A

Explanation:

8 0
3 years ago
The The loudness of a sound is determined by the __________, or height, of the sound wave. A. frequency B. purity C. amplitude D
Rudik [331]

C Amplitude determines the loudness of the sound wave.

5 0
3 years ago
Read 2 more answers
What is the result of a substitution mutation?
expeople1 [14]

Answer:

The new amino acid may be the same as the original amino acid or it may be different.

3 0
3 years ago
Read 2 more answers
Un objeto tiene una densidad de 5g/ml y una masa de 57ml cual es su masa
laila [671]
The mass of the object is 57 ml
5 0
2 years ago
Other questions:
  • The nucleus of the cell membrane is
    8·1 answer
  • Transcription, which is a stage of gene expression, is the process by which genetic information encoded in dna is transferred to
    9·1 answer
  • Many viruses intect only a certain type of cell because they bind to certain
    7·1 answer
  • Where would a new star most likely form?
    10·1 answer
  • How many copies of the 1st chromosome does a human haploid cell contain
    15·1 answer
  • DNA in the nucleus is found in structures called _____. organelles pores ribosomes chromosomes
    10·2 answers
  • The elevation of the basement floor in a building is -14 ft. The elevation of the roof is 36 feet. What is the distance from the
    6·1 answer
  • Help me plz !!!!!!!!!!!!!!!!!!!!!!!!!!!!
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • ITS A TIME LIMIT PLZ HURRY
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!