1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
3 years ago
14

Which base is found in RNA but not in DNA

Biology
2 answers:
Sergeu [11.5K]3 years ago
7 0
Uracil.......I'm pretty sure
SVETLANKA909090 [29]3 years ago
3 0
Uracil. simple answer (: 
You might be interested in
Why does sound travel faster through a solid object than in the air?
RUDIKE [14]

Answer:

Sound travels more quickly through solids than through liquids and gases because the molecules of a solid are closer together and, therefore, can transmit the vibrations (energy) faster.

Explanation:

8 0
2 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
DOES ANYONE KNOW THE ANSWER?
SashulF [63]

Answer:

  • naturally occurring pea plants
  • drought resistant fruit trees
3 0
2 years ago
honeybee is considered as the most useful insect for human beings.justify this statement with any three reasons​
Oduvanchick [21]

Answer:

  • Polinate plants, trees and food
  • They give us honey
  • bees are responcible of pollinating 15 billion of just US crops and 200 million pounds of UK crops. showing their contribution to agriculture

6 0
2 years ago
What do flowers and runners have in common? how are they different?
kompoz [17]

Answer:

Both flowers and runners help a plant to reproduce.

Explanation:

Both flowers and runners help a plant to reproduce. While a flower help in sexual reproduction, a runner helps in asexual reproduction.

A flower has both male and female gamete at one place. When the pollen grains with in a flower reaches the female ovary, a new seed is produced  which has the potential to develop into new plant. In case of runner (which is a stem), the tip of the stem has the potential to grow into a new plant

3 0
2 years ago
Read 2 more answers
Other questions:
  • The light reactions of photosynthesis generate high-energy electrons, which end up in __________. the light reactions also produ
    15·1 answer
  • Most materials are not magnetic because
    5·2 answers
  • What is an advantage of a degenerate genetic code?
    10·1 answer
  • Describe the cycle that involves soil decomposed and other living things
    13·1 answer
  • Matthew takes two 50-milligram iron tablets each day. How many<br>grams of iron does he take daily?​
    13·1 answer
  • N a dihybrid cross for round and yellow seeds (RrYy x RrYy), what is the probability of having green and wrinkled seeds?
    7·2 answers
  • A decrease in cell-cell adhesion was caused by the introduction of an experimental substance that compromised the structural int
    8·1 answer
  • What limts carrying capacity?<br>A:Energy<br>B:Water<br>C:Oxigen<br>D:Space<br>E:All of the above​
    5·2 answers
  • State one specific response of the body to the increase in blood glucose level that would account for the changes that begin abo
    14·2 answers
  • What is the typical configuration of chromosomes in eukaryotic cells?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!