1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
5

Which layer of the atmosphere is closest to the surface of Earth?

Biology
2 answers:
Lorico [155]3 years ago
4 0

Answer:

<em>Its A.) troposphere</em>

Explanation:

I took the k12 test

bixtya [17]3 years ago
3 0

Answer:

thermosphere

Explanation:

i think that one

You might be interested in
The highest amount of a nutrient that can be consumed without likely harm in a group of individuals of a similar age is the
Harman [31]

Answer:

B

Explanation:

Tolerable Upper Intake Level is the nutrient individuals in a group of the same age can take daily in an unquantifiable amount because it has no inimical effect

3 0
3 years ago
What is the relationship between air pressure and wind velocity?
Pachacha [2.7K]

Explanation:

Velocity refers to how fast the air is moving in distance per unit of time. While pressure is the measure of force applied on an area.

7 0
3 years ago
Which of these describes a scientific theory?
lesya692 [45]

Answer:

good question

Explanation:

4 0
4 years ago
Read 2 more answers
What factors determine a nation's human development index (hdi)?
alisha [4.7K]

These are the factors that determine a nation's human development index (HDI):

1. Average life and health expectancy

2. Education- literacy rates, and ratio of students who are enrolled in primary, secondary and tertiary levels

3. Individual income- a person’s income against the gross domestic product (GDP)

4 0
4 years ago
Read 2 more answers
What force is jumping on a trampoline a push or a pull
sergeinik [125]

Answer:

I think that it is pull.

8 0
4 years ago
Read 2 more answers
Other questions:
  • How do Salmonella bacteria in the gut microbiome affect the body?
    9·1 answer
  • What is the function of the reproductive system
    9·1 answer
  • Whaere is the nucleus found
    15·2 answers
  • Which substitution mutation has the potential to cause more damage?
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • I have seen that there is a new species of spider found that has wings. Is this true? If so do they fly or glide? And are they f
    13·1 answer
  • What causes an ecosystem to move from a primary successional stage towards a relatively-stable mature ecosystem?
    9·1 answer
  • Please answer ! Best answers will be marked as brainliest and will be given thanks and 5 stars , Any unnecessary answer , will b
    13·1 answer
  • Which of the following does water pollution affect: surface water, ground Water, or ocean water?
    11·1 answer
  • List one factor that you imagine would limit settlement on top of living organisms. The panels hang vertically from the side of
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!