1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
6

Give an example of a decomposed. Explain what would happen if decomposers were absent from a forest ecosystem.

Biology
1 answer:
DerKrebs [107]3 years ago
3 0

Answer:

Some examples of decomposers include bacteria, fungi, and some insects. If decomposers disappeared from a forest ecosystem, wastes as well as the remains of the dead organisms would pile up, and producers (plants) would not have enough nutrients.

You might be interested in
Fill in the blank with the appropriate term. 1.The___________ is often considered to be the cell's control center. 2.The________
ValentinkaMS [17]
 1.The nucleus is often considered to be the cell's control center.
(because it contains the DNA)

2.The cytoplasm consists of everything inside the plasma membrane of the cell.
(actually it excludes the nucleus)

 3.The plasma membrane forms a boundary between the inside and outside of the cell. - it controls what can enter and what can't!


4.The cytoskeleton is essentially a "skeleton" inside the cell..
it maintains the form of the cell

5.The rough endoplasmic reticulum is covered with
Ribosomes -they make the proteins!


6.Lysosomes use enzymes to break down foreign matter and dead cells.

 7.plant cells cells specifically have a cell wall, a large central vacuole, and chloroplasts.-choloplasts are only found in plants!

3 0
3 years ago
Read 2 more answers
What primarily happens during the light-dependent reactions of photosynthesis? What 2 reactions does solar energy drive during t
andrey2020 [161]

Answer:

During light reaction of Photosynthesis ATP and NADPH are formed.

Explanation:

Reactions driven by solar energy

      H2O=H+  +   OH-

       4OH-   - 4e-  =4OH

        4OH=2H2O+O2

Second reaction

NADH+e- +H+=NADPH

Carbon dioxide fixation occurs during Calvin cycle.Carbon dioxide is being fixed into glucose molecule.

The name of the enzyme is Ribulosebisphosphate Carboxylase(RUBISCO)

The normal substrate for this enzyme is Ribulose bisphosphate(RUBP)

4 0
3 years ago
Which of the structures shown above contains a nucleolus?
Margaret [11]
A Nucleus; inside of a cell; inside of a plant or animal cell; inside of a plant <span>or animal; you can take it from there :) :)</span>
8 0
3 years ago
What is hypertension and what are some factors that affect it?
tigry1 [53]
A condition in which the force of the blood against the artery walls is too high.
Usually hypertension is defined as blood pressure above 140/90, and is considered severe if the pressure is above 180/120.
5 0
3 years ago
Increasing muscle mass and decreasing fat content in your body can increase ones use of energy. Why is this?
kobusy [5.1K]

Explanation:

Muscle tissue is metabolically more dynamic and burn a larger number of calories than fat tissue. The more muscles you have, the greater your resting energy expenditure, which implies that your body burns more calories while sitting idle

8 0
2 years ago
Other questions:
  • In a particular zoo the population of spider monkeys has a higher proportion of individuals with light golden brown fur than spi
    9·1 answer
  • Describe Why :
    9·1 answer
  • Why is it difficult to classify some bacteria and archaea from each other?
    11·1 answer
  • Which of the following is NOT an interpretation that can be made from an age structure diagram? the rate of change in population
    5·2 answers
  • Jill is always tired, has sluggish movements and appears to be depressed. she has gained weight and her skeletal muscles are wea
    9·1 answer
  • Which description is incorrect for the layers of the heart and its serous membranes?
    8·1 answer
  • What does it mean when a tree is said to be dormant?
    6·1 answer
  • How do proteins work?
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is a cell that is the source of other cells
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!