1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnyKZ [126]
3 years ago
11

Methylamine (ch3nh2) is a weak base. at equilibrium, which expression equals the base dissociation constant (kb) of methylamine?

Chemistry
1 answer:
Molodets [167]3 years ago
4 0
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

Below are the choices that can be found elsewhere:

a. [CH3NH-] * [OH-] / [CH3NH3+] 
<span>b. [CH3NH3+] / ([CH3NH2] * [OH-]) </span>
<span>c. [CH3NH3+] * [OH-] / [CH3NH2] </span>
<span>d. [CH3NH3+] * [OH-] / [CH3NH2] * [H2O] 
</span>
The answer is C. 
You might be interested in
Please help asap,
Finger [1]
10. Capital C and D represent products of chemical reaction, the capital A and B represent reactants, <span>the lower case letter represent coefficients (how many atoms or molecules in chemical reaction).
12. According to </span><span>Le </span>Chatelier's principle (if<span> the concentration is changed, that will shift the equilibrium to the side that would reduce that change in concentration)</span> <span>the equilibrium shift to the left.
13. </span>According to Le Chatelier's principle the equilibrium shift to the right.
14. According to Le Chatelier's principle (<span>When the reaction is </span>exothermic<span>, heat is included as a product)</span> the equilibrium shift to the right.
5 0
3 years ago
Is more chemical weathering likely to occur in New York location or in the Illinois location? Explain your answer. HELP NEEDED (
Naily [24]
The pH of pure water is 7.0, which is neutral.

For a pH below this, the water is acidic. Substances that are acidic are often corrosive and thus could cause weather damaging. The pH of the precipitation in NY is below that of the precipitation in IL, and NY receives more precipitation, so for both of those reasons, it is likely to have more chemical weathering.
3 0
3 years ago
When can polar bears take care of themselves
Viefleur [7K]
around the age of two they might start to kinda ''leave''(or venture) there parents

5 0
3 years ago
A change in the water temperature of the pacific ocean that produce warm current
liraira [26]
This is true, this isn't a question, it's a fact.
6 0
3 years ago
In which compound do the atoms have the greatest difference in electrongativity?
weqwewe [10]

Explanation:

cesium fluoride is one of the compound

5 0
3 years ago
Other questions:
  • Identify the missing daughter nucleus in the β– emission decay of 106ru below.
    7·1 answer
  • What is radium used for
    15·1 answer
  • WILL GIVE BRAINLIEST!!!
    13·1 answer
  • Which statements describe an element? Check all that apply.
    5·2 answers
  • Is spilling cake batter a physical or a chemical change?<br>Explain why?
    13·2 answers
  • It’s a organic chemistry
    7·1 answer
  • Which of the following statements is true?
    6·1 answer
  • Which of the following numbers is in scientific notation?
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • For X + Y → XY, if [XY] is increasing at a rate 0.10 M s-1, predict the rate of depletion of both reactants.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!