The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Both the plant and the bacteria benefit so the answer is mutualism.
Hope it helped!
Answer:
Somatic cells include a all except skin cells
Autopsy’s allow people to know the cause of death of the person. They can tell you if the person was intoxicated, injured, how they were killed, also it can be a huge evidence source to solve other cases that have similar causes of deaths. Hope it helps :)
Answer:
organic chemistry I believe so
Explanation:
good luck