1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leno4ka [110]
3 years ago
13

What substance is made from the energy that comes from broken carbohydrate bonds?

Biology
1 answer:
KATRIN_1 [288]3 years ago
8 0
ATP comes from broken carbohydrate bonds.
You might be interested in
Eukaryotic cells are 10-100 times the size of prokaryotic cells. how do eukaryotic cells resolve the surface area to volume limi
Katarina [22]

The surface area of a cell is approximated by the surface area of a sphere, given by the expression, 4πr². The volume of the spherical cell is given by the expression, 4πr³/3. The ratio between surface area and volume turn out to be, 1:r/3, or 3:r. This indicates that the SA/volume ratio is inversely related to the radius of the cell. Greater the radius, lower the ratio. Higher ratios are present in the prokaryotic cells This enables them to exchange food and water from their environment by the simple process of osmosis and diffusion. Eukaryotes have a larger cell radius and size. Thus, eukaryotes find it harder to exchange food and water by simple diffusion, rather they have specialised organelle present in the cell that actively transport food and water into the cell. These specialised organelles help the cell avoid the problem due to small SA/volume ratio.

4 0
3 years ago
An explosive eruption by a single volcano can affect?
vodka [1.7K]
The air quality for miles because of all the ash released during the eruption and the lava flow can destroy a lot of plant and animal life on the area suronding the volcano
<span />
5 0
3 years ago
The rogue form of prion protein exists primarily in the ________ conformation.
Alex777 [14]

Answer:

beta sheets

Explanation:

  • The proteinaceous particles that lack nucleic acids and are not viruses are termed as prions. 
  • In the healthy brain tissue, the prion proteins are present in the form PrPC, however, in case of prion disease, the normal protein becomes denatured and misfolded and exists in the rogue form which is PrPSc. 
  • The normal form that is PrPC mainly exists in the form of alpha-helices and can bind to copper, however, the rogue form exists mainly in the beta-sheet configuration and is resistant to proteolysis. 
3 0
3 years ago
What does an alligator need to stay healthy
IrinaK [193]

Answer:

Water and food

Explanation:

Pretty obvious

8 0
3 years ago
A small fish eats part of a plant and then is eaten by a larger fish. The larger fish is then eaten by a shark. What situation h
BabaBlast [244]

Answer:

what level of biology is this?

7 0
2 years ago
Other questions:
  • 8. Much like a cell, a virus is able to
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How do body systems work together to maintain homeostasis
    8·1 answer
  • A student created the data table below using a computer simulation of coal
    7·2 answers
  • A child presents with bone deficiency and a bowlegged appearance. This assessment data supports a diagnosis of Rickets
    15·1 answer
  • The synthesis of atp from adp and pi is a(n) _____ reaction with ____ δg. Endergonic; a negative exergonic; a positive endergoni
    7·2 answers
  • Explain how this enables the bacterium to detect the population density
    6·2 answers
  • A redwood tree, Sequoia sempervirens is hexaploid with a total of 66 chromosomes. Considering this, how many chromosomes did the
    11·1 answer
  • How many liters of air do you breathe in one hour
    8·2 answers
  • Don't know if this is the correct answer. Help please.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!