1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
13

a scientist isolates a number of non photosynthetic prokaryotes which structure would be found in theses cells​

Biology
1 answer:
EleoNora [17]3 years ago
3 0

Answer:

As these cells are non-photosynthetic, all other organelles would be found in these cells except for chloroplasts which contain photosynthetic pigments used for photosynthesis. A few examples of structures found within these cells would be cell wall, cell membrane, cytoplasm, ribosomes, nucleoloid and many others. Do note that prokaryotic cells do not have organelles with membranes hence they do not have mitochondria or lysosomes or endoplasmic reticulum etc.

Explanation:

You might be interested in
Explain how human activities can cause an imbalance in biogeochemical cycling and lead
Elza [17]
Human activites  have greatly increased carbon dioxide levels in the atmosphere and nitrogen levels in the biosphere. Altered Altered biogeochemical cycle combined with climate change increase the vulnerability of biodiversity, food security, human health, and water quality to a changing climate.
4 0
3 years ago
What happens if a cell is damaged but does not initiate apoptosis?
inysia [295]

Answer:

e

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the examples below illustrates a homologous body structure?
AlladinOne [14]

The forearm of birds, reptiles, and humans illustrates a homologous body structure.

  • Similar physical characteristics found in species with a shared origin are known as homologous structures, although these characteristics have entirely different biological purposes.
  • The limbs of humans, cats, whales, and bats are examples of homologous structures.
  • All of these structures—arm, leg, flipper, and wing—are supported by the same type of bone structure.
  • The arms of a person and the wings of a bat are excellent examples of homologous structures. Because both bats and people are mammals, they have a common ancestor.
  • Even though they appear considerably different from one another from the outside, a bat's wing and a human arm have remarkably comparable internal bone structures.
  • Wings help bats fly, whereas arms enable human interaction with their environment. The wing and the arm also have various purposes.

learn more about homologous structures here: brainly.com/question/7904813

#SPJ1

3 0
1 year ago
What can be done to dominate the proper use of cellphohe?​
fiasKO [112]

Answer:

shhhh thats wht u did to me beach

Explanation:

7 0
2 years ago
HELPP PLSSS :) American pikas are prey to long-tailed weasels. Which change in a limiting factor would increase the carrying cap
Damm [24]

Answer:

A. increase in American pika population size

Explanation:

Carrying capacity is the idea that relates to how much population can an environment sustain before collapsing. Here, the answer would be A. increase in American pika population size  because if you increase the food for weasals, naturally the population carrying capacity goes up because now the environment has food to feed the weasals which can contribute to increasing the carrying capacity (i.e. the environment can now handle larger population of weasel than initial condition)

6 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following cells is most likely to have the greatest trouble repairing damaged DNA? Which of the following cells is
    15·2 answers
  • Choose all the answers that apply.
    13·1 answer
  • Based on scientific research, which statement best describes mutations?
    10·2 answers
  • 11. What is the number of times a machine multiplies force called.
    6·1 answer
  • A scientist decides to study the effect of salt on a particular type of bacteria. Arrange the steps of the scientific method in
    15·1 answer
  • Which component of blood allows oxygen from the air to move from the lungs to cells of the body?
    14·2 answers
  • What is missing from the venn diagram PLEASE HELP!!
    11·1 answer
  • Example of natural system of classifying organisms​
    10·1 answer
  • Part b what does president obama suggest that we should do about these problems? do you agree with him? why or why not?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!