1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
3 years ago
11

Nucleic acids are composed of monomers called?

Biology
1 answer:
zhenek [66]3 years ago
4 0
Nucleic acids are composed of monomers called Nucleotides

Nucleic acids are made of monomers known as Nucleotides, and there are 3 parts to Nucleotides - They are a nitrogenous base, a pentose sugar and a phosphate group
You might be interested in
Name the 7th Planet from the Sun ☀️
vladimir1956 [14]

Uranus is the answer

5 0
3 years ago
Read 2 more answers
The trees in a forest all have closed stomata. what is the cause?
ivanzaharov [21]
This is to prevent water loss by the trees. Under drought or dry conditions, plants may close their stomata to limit the amount of water that evaporates from their leaves a process called transpiration. In this process water diffuses through the stomata into the atmosphere, in a bid to preserve water plants may close their stomata, especially during very dry climates.
3 0
3 years ago
There are different types of nerves or mechanoreceptors located in your skin. Nerves that detect deep pressure are called _____.
UNO [17]

Nerves that detect deep pressure are called Pacinian corpuscles.

Pacinian corpuscles are microscopic onion-shaped nerve structures that are situated in the dermis and hypodermis. Pacinian corpuscles detect deep pressure and vibration. This nerve has a myelinated nerve ending in the middle of its structure and the external layer contains flattened cells, a lymph-like fluid and collagen fibers. The structure of pacinian corpuscles provides a fast response and rapid recovery by transmitting fast events. This make them sensitive to pressure and vibration.


7 0
2 years ago
Read 2 more answers
2+2=???? idkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidk
Tasya [4]

Answer:

4

Explanation:

2+2=4. It is a very complex equation. Hope this helps!

-Aslina

7 0
3 years ago
Help are they c o or h
Mekhanik [1.2K]

Answer:

1-h

2-c

3-h

4-h

5-h

6-h

7-o

8-c

9-c

10-c

Explanation:

8 0
3 years ago
Other questions:
  • Explain why the formation of abscission layer causes sugar to accumulate in leaves.
    11·1 answer
  • Indicate if the following statements about prokaryotes are true or false. A. They contain a plasma membrane B. They contain inte
    6·1 answer
  • If the root equi- means "equal," what does equinox mean?
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • HELP PLEASE WITH SCIENCE! 50 points for whoever gives me an understandable answer for a 13 year old! Thank you!
    14·1 answer
  • What conditions allow for the exponential growth of a population?​
    15·1 answer
  • Which of these is an indicator of the age of a woody plant?
    14·1 answer
  • Please please help it due in an hour!!!! ;-; I'll give brainlst to whom ever is correct!!
    15·2 answers
  • Solar and wind energy are renewable or non renewable sources of energy plz tell me fast​
    10·1 answer
  • A nurse is explaining to another nurse the difference between first-generation antipsychotics and second-generation antipsychoti
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!