1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
7

Proteins are made up of Proteins are synthesized on

Biology
1 answer:
adell [148]3 years ago
6 0
Proteins are made up of smaller building blocks called amino acids

Proteins are synthesized in ribosomes
You might be interested in
Human cells have 46 chromosomes. Each chromosome consists of a pair of identical chromatids attached together by a structure cal
eduard
10 chromosomes. After telophase and cytokinesis, the new daughter cells will each have 10 chromosomes, which is identical to the parental cell. Human cells have 23 pairs of chromosomes.
6 0
3 years ago
Why does the northern hemisphere experience Spring in March, while the Southern Hemisphere experiences fall?
Assoli18 [71]

Explanation:

because the tilt of the earth on its axis

7 0
3 years ago
Read 2 more answers
Unicellular cells must carry out ___ of life.(1 point) A. all functions B. a few functions C. a single function D. specific func
Aleonysh [2.5K]

Answer:

all functions

Explanation:

To survive, unicellular cells must carry out all functions.

Hope this helps!

3 0
3 years ago
Read 2 more answers
The length and complexity of a food web in the arctic would be ____________ when compared to one in the tropical rainforest.
kumpel [21]

Answer:

Explanation:

yes

7 0
3 years ago
If the gfr is too low, needed substances may pass so quickly through the renal tubules that they are not absorbed and instead ar
stich3 [128]
The statement above is FALSE.
Glomerular filtration is the process by which the kidneys filter the blood by removing excess wastes and fluid. Glomerular filteration rate [GFR] is a measure of how well the blood is filtereed by the kidney. If the value of a GFR test is too low that indicates that the kidney is not working well.  <span />
4 0
3 years ago
Other questions:
  • Regrowth of grass, ferns, wildfloeers after a wildfire is an example
    13·1 answer
  • Which of the following is NOT a function of Earth's atmosphere?
    11·1 answer
  • According to Plato and the traditional definition of knowledge, having a true belief is sufficient to have knowledge.A. TrueB. F
    10·1 answer
  • The five body functions that monitor homeostasis
    9·1 answer
  • What changes can occur in an aquatic ecosystem as a result of nutrient loading?
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How does science help society?
    10·2 answers
  • What are genetic variations? Give an example.
    10·2 answers
  • DNA replication occurs during<br> a) S phase<br> b) Mitosis<br> c) G1 phase<br> d) Prophase
    10·1 answer
  • When is it more appropriate to use presumptive tests in a crime investigation? When is it more appropriate to use confirmatory t
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!